Сайт создан на платформе Nethouse. Хотите такой же?
Владельцу сайта

Тэг: Александр Кушелев

Резюме метода Пикотехнологии

Human Genome Protein Structure


На сегодняшний день Лабораторией Наномир по методу Пикотехнологии выполнена база белковых структур "Human Genome Protein", расположенная по этим адресам:

Part 1: https://cloud.mail.ru/public/BJeH/PdR6tFSsR

Part 2: https://cloud.mail.ru/public/Jxkq/Yt3GQAcC8

База содержит структуры всех белков человека, для которых известна нуклеотидная последовательность 

(24 хромосомы, 114 419 кодирующих нуклеотидных последовательностей).


Посмотрите выборочные примеры структур белков, кодируемых 1  23, 

3-14, 5, 78,  9, 101112, 13, 14, 16, 17, 18 20, 21, 22(Y) хромосомами человека, а также примеры некоторых других "монстров" хромосом по ссылке .


Всего у человека 24 хромосомы. Общее число белков около 5 000 000. 


С помощью рентгеноструктурного анализа за всю историю его существования, во всех странах вместе взятых смогли определить около 100 000 структур белка. И то - половина неправильно. Это обошлось заказчикам в миллиард долларов. 


Все белки человека рентген не покажет даже за триллион триллионов долларов -  только 3%, которые кристаллизуются.

Для их исследования методом РСА не хватит и миллиона лет.


Мы выполним точную пикоструктуру интересующего Вас белка за неделю.


Для исследователей разработана удобное графическое представление 2D и 3D структур Пикотех гигантских бековых молекул.


Ваша заявка должна содержать лишь код интересующего Вас белка из базы данных PDB, либо мРНК для него.




ПРЕАМБУЛА


В настоящее время одним из популярных алгоритмов моделирования пространственной структуры белка, который исходит из его аминокислотной последовательности, является способ построение модели по гомологии на основе общего структурного шаблона. 


Разработан новый способ моделирования структурного шаблона белка по детерминирующей его нуклеотидной последовательности, поскольку информация о топологии вторичной структуры белка и его индивидуальном  структурном шаблоне  содержится непосредственно в гене каждого белка. Эта информация может быть декодирована в соответствии с таблицей генетического кода структурного шаблона белка авторскими программами Пикотех (PT) и Молекулярный конструктор (МС) в виде координатного файла в pdb-формате. 


Важным достоинством метода является то, что можно построить структурный шаблон индивидуально для любого неизвестного белка лишь “прочитав” детерминирующую его нуклеотидную последовательность. Такой шаблон служит единой матрицей для пространственной структуры всех молекул данного белка в ходе посттрансляционного фолдинга in vivo и виртуального фолдинга или докинга in silico.


Модели белковых молекул в Пикотехнологии  предполагают наличие "жестких" кольцеобразных структур в электронных оболочках атомов, соединяющихся в многогранники. Это позволяет нам типологизировать формы участков белковых молекул и точно описать их в трехмерном изображении, с точностью до пикометра.


Структура 2D диаграммы Пикотех


СОКРАЩЁННАЯ ДИАГРАММА


Красный - альфа-спираль.
Оранжевый - 310-спираль.
Розовый - одиночный код альфа/310 спиралей.
Голубой - пи-спираль.
Зеленый - бета-спираль.
Сиреневый - метиониновая спираль. У неё более крупный шаг "резьбы", чем у обычной альфа-спирали.
Черный в сокращённом представлении и белый в развернутом означают либо неизвестный код, либо конец трансляции.
Циклическое повторение цветов - программная спираль.


http://img-fotki.yandex.ru/get/6210/126580004.53/0_bcc31_366c6e2c_S.gif http://img-fotki.yandex.ru/get/6304/126580004.53/0_bcc32_4f52ef7b_S.gif http://img-fotki.yandex.ru/get/6302/126580004.52/0_bcc2f_a96d98c5_S.gif http://img-fotki.yandex.ru/get/6307/126580004.52/0_bcc30_b4791ec4_S.gif
Альфа-спираль Бета-спираль Пи-спираль 310-спираль Метиониновая спираль


  

https://img-fotki.yandex.ru/get/898391/158289418.498/0_1859fc_e2e79c6_orig.png


ПОЛНАЯ ДИАГРАММА


Содержание столбцов


1 - порядковый номер аминокислотного остатка в белковой молекуле
2 - триплетный код
3 - однобуквенный код аминокислотного остатка
4 - трёхбуквенное обозначение аминокислотного остатка
5 - упрощённый композиционный код
6 - графическая интерпретация упрощенного композиционного кода
7 - композиционный код
8 - графическая интерпретация композиционного кода
9 - нота, которая звучит при установке данной аминокислоты в растущую белковую цепь
10 - графическое изображение ноты (или ударного инструмента)
Для новой версии Пикотех 2018 разработан Композиционный код 7var
https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae92_83cc91e_orig.jpg
Программные спирали - повторение последовательности композиций. Например, один код альфа-спирали, затем один код пи-спирали. n(35) задаёт программную спираль, а n3 или n5 - простые спирали (пи-спираль и альфа-310-спираль).
1111111111111111111 - прямая альфа-спираль
4444444444444444444 - прямая 310-спираль
3333333333333333333 - прямая пи-спираль
2222222222222222222 - прямая бета-спираль
232323 - программная 23-спираль
141414 - программная 14-спираль

Композиционный генетический код.


http://nanoworld.org.ru/post/94081/#p94081

https://img-fotki.yandex.ru/get/509063/158289418.498/0_1859fd_27b43600_orig.png



Триплеты ДНК кодируют аминокислоты. В упрощённом представлении третья буква триплета управляет углом поворота. Это показывают пикотехнологические 3D модели аминокислотных остатков. Один аминокислотный остаток можно повернуть относительно другого на углы 0, 120 и 240 градусов.  Для описания пространственных структур белковых молекул представлен Композиционный генетический код. 

Подробнее


Согласно методу Пикотехнологии, электрон имеет "скелет" в виде кольца диаметром типа 1.7 ангстрема (для внешних оболочек водорода, углерода, азота, кислорода). Кольцевые "скелеты" электронов формируют кольцегранные электронные оболочки и кольцевые механизмы молекул. Модели этих механизмов показывают, как складываются альфа-спираль, 310-спираль, смешанные альфа-310-спирали, пи-спирали и бета-спирали, которые оказались не по 2 остатка на виток.


Композиционный генетический код 4var, 6var и 7var


В Диграммах Пикотех применяются три вида композиционного генетического кода – коды 4var, 6var и 7var. 
Код "2" (спираль - не спираль).
Код 4var более подробный (альфа-, бета-, пи-, 310-).
Код 6var ещё более подробный. В нём есть различие "одиночный альфа-код", "код альфа-спирали", "код 310-спирали", "Код метионина в составе спирали". 
Код 7var  различает одиночный код пи-спирали от кода в составе пи-спирали .


В настоящее время считается, что белок в неопознанной части структур, полученных методом РСА, не имеет определенной структуры, но пикотехнология показала, что это не так. В программе "Пикотех" вся структура определена.


Пикотехнология не может определить структуры, полученные не по программе рибосомой. Если после сборки белка он обработан ферментами, например, разрезан и переделан, то программа "Пикотех" об этом не даёт информации.


Построение 2D Диаграмм и структур 3D Пикотех


Алгоритм построения Пикотехнологических моделей белков основан на открытии Композичионного генетического кода, см. монографию А.КУшелева и В.Соколик "Геометрия живого наномира. Пикотехнология белков". Структуры  2D Пикотех строятся с достоверностью 100% в автоматическом режиме.  Структуры 3D Пикотех  в зависимости от состава молекул строятся в автоматическом режиме (геометрический алгоритм) либо в ручном режиме (с учётом физико-химических взаимодействий и свойств сустава Pro). Метод построения структур 3D Пикотех на базе 2D структур Пикотех является ноу-хау Лабораторатории Наномир.


Примеры структур 2D и 3D Пикотех


Пикотехнологическая модель гистонного комплекса
http://nanoworld.org.ru/post/96354/#p96354

Пикотехнологические 2D и 3D модели длинных спиралей 

http://nanoworld.org.ru/topic/1837/ http://nanoworld.org.ru/post/91815/#p91815 , http://nanoworld.org.ru/topic/1656/page/5/ 

Три надежных метода проверки Пикотехнологии


Первый - достоверная корреляция с данными РСА. Конечно, РСА не даёт высокой достоверности, но она часто выше 50%.

На таких белках, как инсулин, гемоглобин, окситоцин корреляция приближается к 100%, т.к. в окситоцине, например, есть замкнутые циклы через дисульфидные мостики. Это позволяет проверить и РСА, и Пикотех.


Второй - замкнутые через дисульфидные мостики циклы типа окситоциновых. Вероятность случайного замыкания шести циклов, насчитывающих десятки аминокислотных остатков из разных окситоцинов, порядка 1/30 000 000 000. Речь идёт о вероятности для каждого цикла - все шесть могут случайно замкнуться с вероятностью (1/30 000 000 000)^6.


Третий - самоповерка на примере сверхдлинных базовых и программных спиралей, где наблюдается 100%-ная корреляция между вторичной и первичной структурами.


Четвёртый - микроскопия. 3D модель "монстра" первой хромосомы хороша тем, что её можно проверить, рассматривая молекулу белка в флуоресцентный микроскоп. "Монстр" первой хромосомы такой крупный, что его  видно в микроскоп в отличие от мелких белков. В частности, диаметр начальной фрактальной петли (правая часть) примерно 100 нанометров,  т.е. 0.1 микрона. 


https://img-fotki.yandex.ru/get/874316/158289418.4bc/0_18a505_811b15df_orig.gif

https://img-fotki.yandex.ru/get/9494/158289418.4bc/0_18a589_4694862e_orig.gif


Пикотехнология как дополнение к РСА


Программа Пикотех не может полностью заменить РСА. Однако она очень усиливает самые слабые стороны РСА, а именно достоверно показывает вторичную структуру и ближний порядок расположения атомов третичной структуры в момент сборки белковой молекулы рибосомой.


Чувствительность РСА такова, что он не замечает не только отдельных атомов, но и отдельных аминокислотных остатков. Более того, "хвосты" белковых молекул, которые не кристаллизуются, РСА вообще "не видит", а эти "хвосты" могут насчитывать до 50 аминокислотных остатков.


Особый класс образуют 97% белковых молекул, которые не кристаллизуются. Про них РСА просто ничего не знает, а программа Пикотех так же достоверно показывает их вторичную структуру и ближний порядок расположения атомов в третичной структуре.


 Online service "ProteinPicotech"


Литература


1.Монография А.Кушелев, В.Соколик "Геометрия живого наномира. Пикотехнология белков"  https://www.morebooks.de/ru/search?utf8 … 0%BE%D0%B2  
Предисловие рецензентов и авторов http://nanoworld.org.ru/post/55717/#p55717 
Ознакомиться с началом монографии можно по ссылке http://nanoworld.org.ru/post/54741/#p54741 
2.    Кушелев А.Ю., Соколик В.В. Пикотехнология – новый подход в моделировании пространственной структуры белка / Заочная Международная научно-практическая конференция «Современная наука: тенденции развития» (24 января 2012), Краснодар: НИЦ Априори. – 2012. – С.203-207.
3.    Соколик В.В. Предсказание пространственной структуры белка insilico на основе информации генома и геометрического алгоритма – альтернатива  квантово-механическому подходу // Материалы Международной научной конференции «Математическое и компьютерное моделирование в биологии и химии. Перспективы развития» (28-30 мая 2012), Казань. – 2012. – С.155-158.
4.    Sokolik V.V. Protein is coded in genome and synthesized in ribosomes as a structural template of a rotameric version sequence of peptide bound configuration // The International Moscow Conference on Computational Molecular Biology, МССМВ-11, Moscow. – 2011. – P. 347–348.
5.    Sokolik V.V. Algorithm of protein structural template decoding according to its determined nucleotide sequence // Fist International Conference “Fundamental medicine: From scalpel toward Genome, Proteome and Lipidome”, Pax Grid Virtual Conferences, Kazan. – 2011. – P. 117–119.
6.    Sokolik V.V. Modeling of the individual structural template of protein on determining it nucleotide sequences // VII Международная конференция по биоинформатике, регуляции структуры геномов и системной биологии. BGRS\SB-2010, Новосибирск. – 2010. – С. 275.
7.    Соколик В.В. Способ моделирования пространственной структуры белка по детерминирующей его нуклеотидной последовательности // Биофизический вестник. – 2010. – Вып. 24 (1). – С. 31-45.

http://nanoworld.org.ru/post/96761/#p96761



Вероятность замыкания дисульфидных мостиков в лизоцимах

Вероятность случайного совпадения результата работы геометрического алгоритма с экспериментальными данными ничтожна. Для каждого участка отдельно она не превышает:

1. 4^-18
2. 4^-21
3. 4^-4
4. 4^-4
5. 4^-12

Вероятность угадать все 5 участков не превышает 4^-(18+21+4+4+12)=4^-59 Примерно такая же вероятность случайно нащупать иголку в стоге сена размером с Солнечную систему, не вынимая руки из кармана.


Убедительны ли модельные эксперименты?


Фрагменты моделей белков, замкнувшихся через дисульфидные мостики в процессе автоматической сборки по таблице композиционного генетического кода.


https://img-fotki.yandex.ru/get/107080/158289418.3c1/0_1705b1_dc9f55fd_M.gif https://img-fotki.yandex.ru/get/169883/158289418.3b3/0_16f622_63ae0418_M.gif
https://img-fotki.yandex.ru/get/53993/158289418.3c3/0_170898_94d9b5cd_orig.gif https://img-fotki.yandex.ru/get/98619/158289418.3c3/0_1706b3_7dab967d_orig.gif


Пикотехнолгия помогла найти ошибки рентгено-структурного анализа

Как устроены реальные программные спирали белка


Модель коллагена (программная 335-спираль) -  яркая демонстрация несовершенства рентгеноструктурного анализа. Специалисты по РСА конструируют спираль коллагена из того, что им известно. А известна им альфа-спираль. Вот они и сконструировали модель из 3 альфа-спиралей. Программа Пикотех показывает, что это не тройная, а одинарная, но программная 335-спираль. Радикалы аминокислот действительно располагаются в виде трёх-заходной спирали, что и сбило с толку специалистов по РСА.

Другие программные спирали специалисты по РСА тоже ошибочно интерпретируют известными им "базовыми спиралями", но настало время показать, как устроены реальные, программные спирали белков.

Другими яркими примерами, демонстрирующими несостоятельность РСА, являются  сверхдлинные, в том числе программные спирали.

Наконец, Пикотехнология в отличие от РСА имеет возможность самоповерки. В частности, самоповеркой является 100%-ная корреляция между первичной и вторичной структурой некоторых белков, например, сверхдлинных программных спиралей. Спирали длиной более 1000 витков исключают случайные совпадения, согласитесь. Например, вероятность случайного совпадения композиционных кодов для 310-спирали длиной более 3982 аминокислотных остатков не превышает 4^-3982=2.5*10^-2397, т.е. более двух тысяч нулей после запятой.    

Подробнее об этом белке можно прочесть здесь.

 


https://img-fotki.yandex.ru/get/4000/158289418.421/0_17aaf5_65d3d6c0_orig.gif

3D стркутуры Пикотехнологии, построенные по геометрическому алгоритму

vtvtvtv

ngngng
vxvxv

https://www.ncbi.nlm.nih.gov/protein/97 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/973106333

KUK63703

>ENA|KUK63703|
ttgggttcaggtacaaacgccagcaccctttctgaaactgttactgttactgttactgtt
actgttactgttactgttactgttactgtta ctgttactgttactgttactgttactgt
tattatataa

https://img-fotki.yandex.ru/get/94189/158289418.3e3/0_176b26_1f5e86bb_orig.png

https://img-fotki.yandex.ru/get/176508/158289418.3e3/0_176b49_61ac4e78_orig.gif

https://img-fotki.yandex.ru/get/195125/158289418.3e3/0_176b4a_3201ca6a_XL.png

https://img-fotki.yandex.ru/get/169608/158289418.3e3/0_176b4c_f058f2ed_XL.png


***
https://www.ncbi.nlm.nih.gov/protein/10 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/1095318419

SEK15922

>ENA|SEK15922|
gtgcagaggcatgggcagacgcccaagatatcctcccagcagctctctgggccagtcatc
gccaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcacc
gtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcgactttgccatgccattgccg
gcaaccggtcattgcacttga

https://img-fotki.yandex.ru/get/42692/158289418.3e3/0_176b28_33431273_orig.png

https://img-fotki.yandex.ru/get/58675/158289418.3e3/0_176b4d_5f5ee0c4_orig.gif

https://img-fotki.yandex.ru/get/174613/158289418.3e3/0_176b4e_fe8dbf4e_XL.png

***
https://www.ncbi.nlm.nih.gov/protein/68 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/682348964

KFY41221

>ENA|KFY41221|
aaactttttacgtctataatatcccctttaccgtacgtcaccgtcaccgtcaccgtcacc
gtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcacc
gtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcacc
gtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccccccagccagcc
gtggcgcatgtccacacatga

https://img-fotki.yandex.ru/get/176508/158289418.3e3/0_176b25_3cb175bb_orig.png

https://img-fotki.yandex.ru/get/169608/158289418.3e3/0_176b50_c939ebf2_orig.gif

https://img-fotki.yandex.ru/get/169608/158289418.3e3/0_176b4f_b6137aca_XL.png

***
https://www.ncbi.nlm.nih.gov/protein/10 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/1028550392

OAJ20702

>ENA|OAJ20702|
atgagcaggtcgttgagacaacctctgttcccaacacccacgctcgcatttcaagatgca
caagtaagtgtctggctcattgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtc
accgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtc
accgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcntaagtgtttctcttgcc
ctcatcgcccagccttgtcgacacgacttcacactcgttctcactgttcgctga

https://img-fotki.yandex.ru/get/52085/158289418.3e3/0_176b27_4eeef3bb_orig.png


***
https://www.ncbi.nlm.nih.gov/protein/92 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/929747320

XP_014148644

>ENA|XP_014148644|
atgggacctcagaggctcagactcacagccacagccacagtcacagtcacagtcacagcc
acagtcacagtcacagtcacagtcacagtcacagtcacagtcacagtcacagtcacagtc
acagtcacagtcacagtcacagttacagtcccagtcacagacactagtagaggactagag
tctcagactccctcagagtctcagatgcagaactgcggcgaagggagacggtcgagaaag
cctcacgcaggagagtgtctaagactcttagtgggtgggggtcacagactgagacagcct
gacaagtga

https://img-fotki.yandex.ru/get/94189/158289418.3e3/0_176b29_282b6f3d_orig.png

https://img-fotki.yandex.ru/get/4526/158289418.3e3/0_176b51_bab21693_orig.gif

https://img-fotki.yandex.ru/get/177849/158289418.3e3/0_176b52_b3e29e7_XL.png

https://img-fotki.yandex.ru/get/28874/158289418.3e3/0_176b53_156f742c_XL.png

https://img-fotki.yandex.ru/get/244791/158289418.3e3/0_176b54_7b8ee6c7_XL.png

https://img-fotki.yandex.ru/get/93500/158289418.3e3/0_176b55_4f0dcfaf_XL.png

Полный комплект файлов: https://cloud.mail.ru/public/2rbQ/1taz9qHr9


    Формы, механизмы, энергия наномира. Сообщение 86 601

    Готовится 597-ой выпуск рассылки "Новости лаборатории Наномир"

    http://subscribe.ru/catalog/science.news.nanoworldnews

    Дайджест:

    597 Открыты 23232(AGAGA)- и 12121-спирали Кушелева
    Классические антигомологи барназа / barnase и биназа / binase
    34343(Q-спираль) и 14141(QVQVQ-спираль) в
    Thioalkalivibrio nitratireducens DSM 14787 protein

    https://img-fotki.yandex.ru/get/243369/158289418.3e2/0_1768db_58a9b35c_orig.png

    https://img-fotki.yandex.ru/get/197807/158289418.3e2/0_1768ca_48de53bd_XL.png

    https://img-fotki.yandex.ru/get/166206/158289418.3e2/0_1768da_e2b18a23_orig.gif

    https://img-fotki.yandex.ru/get/174613/158289418.3e3/0_176a89_e156d2be_XL.png

    https://img-fotki.yandex.ru/get/30752/158289418.3e3/0_176a88_51407844_orig.gif

    https://img-fotki.yandex.ru/get/55828/158289418.3e3/0_176a8e_a93244e3_XL.png

    https://img-fotki.yandex.ru/get/197756/158289418.3e3/0_176a90_e00cc5d2_XL.png

    https://img-fotki.yandex.ru/get/52127/158289418.3e3/0_176a8c_f8137db4_orig.gif

    Полный комплект файлов: https://cloud.mail.ru/public/2rbQ/1taz9qHr9


    Формы, механизмы, энергия наномира. Сообщение 86 627

    Пикотехнология белков, ДНК, РНК - 2

    https://www.ncbi.nlm.nih.gov/protein/30 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/308220123

    >ENA|HM444113|HM444113.1 Mnemiopsis leidyi SIX class homeobox transcription factor SIX13c (SIX13c) mRNA, partial cds

    https://img-fotki.yandex.ru/get/244791/158289418.3e4/0_176c67_863ce06_orig.png

    ***
    https://www.ncbi.nlm.nih.gov/protein/81 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/814601875

    >ENA|KKF96471|

    https://img-fotki.yandex.ru/get/176508/158289418.3e4/0_176c68_8d3dbc66_orig.png
    ***
    https://www.ncbi.nlm.nih.gov/protein/11 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/1111466951

    >ENA|CVL09568|

    https://img-fotki.yandex.ru/get/198026/158289418.3e4/0_176c65_4566d600_orig.png

    ***
    https://www.ncbi.nlm.nih.gov/protein/60 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/602736179

    >ENA|EYT97105|

    https://img-fotki.yandex.ru/get/112407/158289418.3e4/0_176c66_708ca558_orig.png
    ***
    https://www.ncbi.nlm.nih.gov/protein/10 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/1020702258

    >ENA|KZM22758|

    https://img-fotki.yandex.ru/get/111568/158289418.3e4/0_176c69_d16a6e31_orig.png
    ***
    https://www.ncbi.nlm.nih.gov/protein/14 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/147765387

    >ENA|CAN76050|

    https://img-fotki.yandex.ru/get/216168/158289418.3e4/0_176c64_22f5b363_orig.png



      Создан новый стандарт вторичной структуры белка!

      https://img-fotki.yandex.ru/get/108697/158289418.3e4/0_176cab_41977475_XL.png
       http://nanoworld.org.ru/post/85732/#p85732


        Locus KKF96471
        Глядя на схему вторичной структуры легко заметить терминирующие кодоны, которые встречаются после 500-го аминокислотного остатка: https://img-fotki.yandex.ru/get/176508/ … 6_orig.png

        Поэтому 3D модель в действительности состоит из нескольких отдельных моделей разных белковых молекул.

        https://img-fotki.yandex.ru/get/198361/158289418.3e4/0_176cf8_9d1316d5_XL.png

        https://img-fotki.yandex.ru/get/94189/158289418.3e4/0_176cf9_f8e17728_XL.png

        https://img-fotki.yandex.ru/get/244791/158289418.3e4/0_176cf6_3450511d_orig.gif


          Q-спираль (13131-спираль) Кушелева длиной более 200 аминокислотных остатков:

          >ENA|CVL09568|
          https://img-fotki.yandex.ru/get/198026/158289418.3e4/0_176c65_4566d600_orig.png

          https://img-fotki.yandex.ru/get/30536/158289418.3e4/0_176d06_aae8cb52_orig.gif

          https://img-fotki.yandex.ru/get/226123/158289418.3e4/0_176d07_db0043b_XL.png

          https://img-fotki.yandex.ru/get/196365/158289418.3e4/0_176d08_a81c1ffb_XL.png

          https://img-fotki.yandex.ru/get/195431/158289418.3e4/0_176d09_d60bc7c5_XL.png

          https://img-fotki.yandex.ru/get/169883/158289418.3e4/0_176d0a_12fe5ea6_XL.png

          https://img-fotki.yandex.ru/get/52790/158289418.3e4/0_176d0b_1e8c03ad_XL.png

          https://img-fotki.yandex.ru/get/57797/158289418.3e4/0_176d0c_8a39a920_XL.png

          https://img-fotki.yandex.ru/get/228104/158289418.3e4/0_176d0d_aadcf5bd_XL.png

          https://img-fotki.yandex.ru/get/195431/158289418.3e4/0_176d0e_af4417e_XL.png

          https://img-fotki.yandex.ru/get/196183/158289418.3e4/0_176d0f_119a0535_XL.png

          https://img-fotki.yandex.ru/get/30894/158289418.3e4/0_176d10_7aef9c77_XL.png

          https://img-fotki.yandex.ru/get/246231/158289418.3e4/0_176d11_685d4236_XL.png
          Q-спираль по существу является реактором, состоящим из атомов азота...




          https://www.ncbi.nlm.nih.gov/protein/30 … DGPB4AU01R

          https://www.ncbi.nlm.nih.gov/nuccore/308220123

          >ENA|HM444113|HM444113.1 Mnemiopsis leidyi SIX class homeobox transcription factor SIX13c (SIX13c) mRNA, partial cds

          https://img-fotki.yandex.ru/get/244791/158289418.3e4/0_176c67_863ce06_orig.png

          https://img-fotki.yandex.ru/get/225029/158289418.3e4/0_176d97_196ead69_XL.png

          https://img-fotki.yandex.ru/get/169451/158289418.3e4/0_176d98_c1506b98_XL.png

          https://img-fotki.yandex.ru/get/196161/158289418.3e4/0_176d99_edf81e6d_XL.png

          https://img-fotki.yandex.ru/get/60436/158289418.3e4/0_176d9b_9f79a15b_XL.png

          https://img-fotki.yandex.ru/get/42692/158289418.3e4/0_176d9c_e263724d_XL.png

          https://img-fotki.yandex.ru/get/169451/158289418.3e4/0_176d9d_aa817459_XL.png


          https://www.ncbi.nlm.nih.gov/protein/60 … DGPB4AU01R

          https://www.ncbi.nlm.nih.gov/nuccore/602736179

          >ENA|EYT97105|

          Схема вторичной структуры: https://img-fotki.yandex.ru/get/112407/ … 8_orig.png

          На схеме вторичной структуры мы видим терминирующие кодоны. Значит в 3D модели представлено несколько отдельных белковых молекул.

          https://img-fotki.yandex.ru/get/109878/158289418.3e4/0_176dc1_ef9cfd1d_XL.png

          https://img-fotki.yandex.ru/get/9116/158289418.3e4/0_176dc2_ba7df904_XL.png

          https://img-fotki.yandex.ru/get/197807/158289418.3e4/0_176dc3_a58ff018_XL.png

          https://img-fotki.yandex.ru/get/105284/158289418.3e4/0_176dc4_b6415408_XL.png

          https://img-fotki.yandex.ru/get/48807/158289418.3e5/0_176dc5_395b486d_XL.png

          https://img-fotki.yandex.ru/get/9116/158289418.3e5/0_176dc6_6b0b4f76_XL.png
          Похоже, что это вообще другая молекула. Тут нет ни длинной 13131-спирали, ни других признаков, соответствующих вторичной структуре белка EYT97105. Это модели других белковых молекул...


          Формы, механизмы, энергия наномира. Сообщение 86 655

          Пикотехнология белков, ДНК, РНК - 2

          https://www.ncbi.nlm.nih.gov/protein/10 … DGPB4AU01R

          https://www.ncbi.nlm.nih.gov/nuccore/1020702258

          >ENA|KZM22758|

          Схема вторичной структуры: https://img-fotki.yandex.ru/get/111568/ … 1_orig.png

          На схеме вторичной структуры мы видим новую программную спираль:

          https://img-fotki.yandex.ru/get/58784/158289418.3e5/0_176dc7_259400cd_XL.png

          352352-, которая переходит в программную спираль 233233- и далее, в нерегулярную структуру. При этом на протяжении всего участка сохраняется музыкальный размер и периодичность первичной структуры LPG-

          Интересно было бы вычленить эту 3D-подструктуру из полной модели белковой молекулы.

          Полная модель:

          https://img-fotki.yandex.ru/get/50388/158289418.3e5/0_176dc8_c924e4dc_XL.png

          https://img-fotki.yandex.ru/get/166206/158289418.3e5/0_176dc9_7969a735_XL.png

          https://img-fotki.yandex.ru/get/94189/158289418.3e5/0_176dca_3aae89df_XL.png

          https://img-fotki.yandex.ru/get/62701/158289418.3e5/0_176dcb_5f09dc65_XL.png

          https://img-fotki.yandex.ru/get/120031/158289418.3e5/0_176dcc_c316f777_XL.png

          https://img-fotki.yandex.ru/get/58784/158289418.3e5/0_176dcd_ed22e2ea_XL.png

          https://img-fotki.yandex.ru/get/152444/158289418.3e5/0_176dce_c5f57d42_XL.png

          А теперь посмотрим модель фрагмента:

          Locus KZM22758
          FT   CDS 757..837

          https://img-fotki.yandex.ru/get/194425/158289418.3e5/0_176dcf_883f71c6_orig.gif

          https://img-fotki.yandex.ru/get/122076/158289418.3e5/0_176dd0_2e5ca4bb_XL.png

          https://img-fotki.yandex.ru/get/172272/158289418.3e5/0_176dd1_e795a492_XL.png

          https://img-fotki.yandex.ru/get/48807/158289418.3e5/0_176dd2_c9afefa_XL.png


          Интересно, зачем нужно сохранение музыкального размера при переходе одной программной спирали в другую? Хотя ... музыкальный размер как раз не сохраняется. Сохраняется только высота нот.

          Монография В.Соколик , А. Кушелева, "Геометрия живого наномира. Пикотехнология белков".



          Купить книгу





          ПРОЧИТАТЬ ПРЕДИСЛОВИЕ РЕЦЕНЗЕНТОВ



          https://img-fotki.yandex.ru/get/6825/158289418.1da/0_11a59f_92400f64_orig.jpg

          https://img-fotki.yandex.ru/get/15582/158289418.1da/0_11a5a0_9920d12a_orig.jpg

          https://img-fotki.yandex.ru/get/6744/158289418.1da/0_11a5a1_4f339a25_orig.jpg

          https://img-fotki.yandex.ru/get/5812/158289418.1da/0_11a5a2_114eef51_orig.jpg

          https://img-fotki.yandex.ru/get/6740/158289418.1da/0_11a5a3_f52b38b1_orig.jpg




          https://img-fotki.yandex.ru/get/3009/158289418.1da/0_11a5a4_87c7274a_orig.jpg

          https://img-fotki.yandex.ru/get/4524/158289418.1da/0_11a5a5_d1a6c3c6_orig.jpg

          https://img-fotki.yandex.ru/get/16118/158289418.1da/0_11a5a6_8194ce7c_orig.jpg


          https://img-fotki.yandex.ru/get/15572/158289418.1da/0_11a5a7_7f4f4894_orig.jpg

          Подробнее




          The greatest enemy of knowledge is not ignorance, it is the illusion

          Stephen Hawking


          Sokolik VV, Kushelev AY

          Geometry live nanoworld. Pikotechnology proteins / VV Sokolik, AY Kushelev. - Kharkov: Publishing, 2015. – 358 p.


          The monograph is devoted to the 3D-structure of molecules and polymers in living systems. The analysis of the modern understanding of the fundamental concepts of the physical volume of the atom, chemical bonding, and the genetic code is presented. Based on statistical analysis of the experimental data on the protein structure is justified coding secondary structure and structural polypeptide template of protein in the genome. Propose additions table of the genetic code of proteins and peptides, which formed the basis of the geometric algorithm software decoding structural template protein, are Molecular Constructor and Picotex. The hypothesis of recoding information to third nucleotide codon in the corresponding peptide bond rotamer directly 3D-structure isoacceptors tRNA is formulated. Mathematical analysis of contingency angles φ and ψ (Ramachandran map) revealed their frequency changes as possible to substantiate the mechanism of post-translational protein folding.

          The book is intended for professionals involved in research in the field of molecular biology, bioinformatics, biochemistry and biophysics.

          Table: 36. Ill: 117. Refs: 227 titles.


          ПРЕДИСЛОВИЕ РЕЦЕНЗЕНТОВ


          В 21-м столетии в задаче моделирования нанообъектов таких как, атом углерода, органические молекулы, пары комплементарных нуклеотидов и многих других используется кольцегранная модель строения атома. В монографии В.В. Соколик и А.Ю. Кушелева «Геометрия живого наномира. Пикотехнология белков» при помощи кольцегранного подхода к строению атома наглядно (образ – модель) реализуются различные виды, свойства и особенности межатомных взаимодействий, валентные углы в молекулах, разновидности химических связей и их соотношение. Кольцегранная модель реалистично объясняет гибридизацию электронов при формировании химических связей в молекулах, что является краеугольным камнем всей биохимии белкового мира, поскольку атомы углерода в состоянии sp3-гибридизации своих электронов входят в состав скелета аминокислот и таким способом детерминируют углы между химическими связями в их молекулах, а в последующем и в структуре белка в целом.

          В монографии В.В. Соколик и А.Ю. Кушелева «Геометрия живого наномира. Пикотехнология белков» сформулирована идея композиционного генетического кода, кодирования ротамерии пептидной связи и структурного шаблона белка. Показано, что в геноме третьим нуклеотидом кодона детерминирован один из трёх ротамерных вариантов пептидной связи, которым аминокислотный остаток (закодированный дуплетом первых двух нуклеотидом кодона) присоединяется к растущей полипептидной цепи. Ротамерный вариант пептидной связи реализуется в процессе синтеза белка в рибосоме и поэтому с неё сходит индивидуальный структурный шаблон белка в соответствие с информацией, содержащейся в его гене. Данный механизм трансляции генетической информации является эволюционно новым. Его формирование у эукариот было обусловлено необходимостью синтеза больших и сложных белков в виде структурного шаблона, максимально приближенного к функциональной конформации этих белков, чтобы их фолдинг имел наибольшие эффективность и однозначность. У прокариот и органелл эукариот третий нуклеотид кодонов в генах небольших полипептидов ещё не является информационным, поэтому на нём и наблюдается воблирование.

          Выше изложенные положения легли в основу алгоритма авторских компьютерных программ, которые по нуклеотидной последовательности мРНК позволяют смоделировать схему вторичной структуры и 3D-структуру индивидуального структурного шаблон любого белка. Эту первичную информацию о белке можно использовать в дальнейшем моделировании фолдинга функциональной конформации белка с учетом физ-химии его микроокружения, посттрансляционных модификаций, взаимодействия с лигандами методами молекулярной динамики и доккинга наравне с информацией о наиболее стабильном конформере, которую извлекают из рентгенограмм кристаллов белков. Преимущество данного подхода состоит в возможности быстрого моделирования индивидуальной пространственной структуры отдельной молекулы любого белка с точностью до электрона (пикотехнология), опираясь лишь на информацию о нём в геноме. То есть, in silico воспроизводится трансляция генетической информации в индивидуальный структурный шаблон белка. Не исключено, что большинство белков именно из конформации своего структурного шаблона максимально быстро, а главное однозначно, фолдируют в нативную конформацию с минимумом свободной энергии, формируя, таким образом, «устойчивое большинство» конформационно лабильного белкового пула.

          Авторами монографии предложен современный, точный и удобный методологический подход в арсенале молекулярной биологии для моделирования пространственной структуры белков, исходя из той информации генома о них, которой располагает сама клетка.

          Итак, перед читателем книга, вводящая в мир идей и результатов, ориентированных на применение в протеомике кольцегранной модели и молекулярный полиморфизм, основанный на структурном разнообразии биомак-ромолекул. В этой области причудливым и невероятным образом пересекаются достижения многих областей современной науки: физики и химии, биологии и медицины, математики и информатики.

          Доктор физико-математических наук С.М. Шульга

          В настоящее время моделирование пептидов и белков относится к современным и востребованным методическим подходам, позволяющим не только дополнять, но и порой с успехом заменять условно гуманные эксперименты на лабораторных животных, касающиеся взаимодействия различных биогенных соединений с клеточными структурами. К сожалению, дан-ными подходами владеют не многие естествоиспытатели, успешно работающие в своих областях наук. И в этом случае монография В.В. Соколик и А.Ю. Кушелева «Геометрия живого наномира. Пикотехнология белков» позволяет если не овладеть, то, по крайней мере, понять суть применяемых авторами методов построения моделей белков и их кодирования в геноме. Тем более, что книга очень увлекательно и доступно написана. Достигается эта легкость понимания материала тем, что в монографии четко прослеживается научная логика рассуждений и методических подходов авторов. Читателя знакомят с развитием теории строения атома, как с традиционными уже исторически устоявшимися сведениями, так и с новыми интерпретациями кольцегранной структуры атома и аппроксимации геометрии кольцегранной электронной оболочки архимедовыми телами. Авторы пользуются новой «системой координат», их пикотехнология – это технология электронного уровня, разрешение и точность которой сопоставимы с толщиной закольцованного луча-электрона (пикометр – 10-12 м) в атомах белка. Именно этот подход лежит в основе разработанного авторами геометрического алгоритма определения атомного радиуса.

          Одним из важнейших итогов материала монографии В.В. Соколик и А.Ю. Кушелева является реальная возможность с помощью законов геометрии макромира рассчитывать положения атомов в молекуле, не прибегая к квантово-механическим функциям. Такие перспективы обеспечиваются ещё и закономерностями формообразования молекул, которые определены структурой внешних кольцегранных оболочек их атомов, которая, как показано авторами, типична для элементов каждой группы таблицы Менделеева. Сопоставление в монографии экспериментальных данных с представленными моделями протеиногенных аминокислот, рассчитанными геометрическим способом для шаблона многогранных моделей аминокислот, аргументирует убедительность и логичность методологии авторов. Кроме моделей самих аминокислот, авторы уточняют способ объединения их в полипептидах, возможность формирования трех видов ротамеров пептидной связи (R, 0 или L-ротамеров), которые интерпретируются авторами в качестве прототипов соответствующих конформеров вторичной структуры в белках.

          Через призму теории формирования внешней электронной кольцегранной оболочки атома авторы рассматривают последовательно весь геометрический процесс построения пептидов – от пространственной структуры аминокислот до вторичной конформации и этапов фолдинга белковой молекулы. Логичным фрагментом исследований, изложенных в монографии, является объяснение способа и механизма кодирования и декодирования информации о структурном шаблоне белка в геноме.

          Детально охарактеризованы декодированные в программах Molecular Constructor и Picotech В.В. Соколик и А.Ю. Кушелева структурные шаблоны белков в качестве субъектов последующего фолдинга. Представлен количественный сравнительный анализ декодированных структур с соответствующими экспериментальными моделями из базы данных PDB. Особое внимание уделено способам описания пространственной структуры белка и характеристике элементов вторичной структуры, а также современным методам моделирования in silico.

          Следует отметить, что данная монография актуальна не только как научный труд. Собственный интерес авторов к своей работе заражает, более чем полный массивный объем информации, увлекательная и яркая форма ее изложения и оформления делает монографию применимой также и в качестве учебника для студентов естественнонаучных специальностей, особенно таких, как биохимия, биофизика и биотехнология.


          Доктор биологических наук Г.А.Божок


          ПРЕДИСЛОВИЕ АВТОРОВ


          Главная цель, которую поставили перед собой авторы этой книги, это задействование возможностей и закономерностей пространственной геометрии атомов, точнее, их электронных оболочек, в построении моделей белков.

          Почему пикотехнология белков? Мир, с которым мы привыкли иметь дело в обиходе, называют макромиром, базовой единицей измерения которого является метр (м). В конце XIX века был обнаружен микромир, харак-терным размером которого являются габариты атома – ангстрем (1Å – 10-10 м). На базе законов микромира создавалась современная нанотехнология (10-9 м). Еще раньше был открыт мегамир, порядок величин в котором – размер галактик (30 парсек – 1015 м). Поскольку эти миры имеют граничные размеры, значит, за их пределами лежат другие миры, с иным характерным размером, на несколько порядков меньше ангстрема и больше парсека. Пи-котехнология – это технология электронного уровня, разрешение и точность которой сопоставимы с толщиной закольцованного луча-электрона (пико-метр – 10-12 м) в атомах белка.

          Читатель, который не намерен сразу вникать в физический смысл кольцегранной модели атома и химическое обоснование ротамерии пептидной связи, может пропустить первые две главы книги и начинать с принципов декодирования структурного шаблона белка по детерминирующей его нуклеотидной последовательности, а затем из любопытства вернуться к пропущенному.

          Мы не включили в данную книгу разделы о структуре ядра атома и взаимодействии нуклонов, а также большой материал о конформационной подвижности белковых молекул в зависимости от микроокружения. Такое ограничение обусловлено тем, что в геноме детерминированы, прежде всего, уникальные структурные шаблоны белков, трансляция которых в ходе матричного синтеза определяет геометрию электронных поверхностей новосинтезированных белков независимо от микроокружения. Кроме этого, мы, по примеру выдающегося физика-астролога Стивена Хокинга, стремились избегать любых формул.

          Авторы выражают благодарность друзьям и коллегам за обсуждение монографии и рады любым замечаниям, которые помогут её усовершенствовать.


          В.В. Соколик, А.Ю. Кушелев


          ***


          ВВЕДЕНИЕ


          Общая схема построения монографии подчинена логике: «структура общего определяется упорядоченной структурой всех его компонентов». Руководствуясь этой установкой, в 1 главе представлены обоснования и новые интерпретации кольцегранной структуры атома, аппроксимация его физического объёма и геометрии кольцегранной электронной оболочки архимедовыми телами, а также приведен, разработанный авторами, геометрический алгоритм определения атомного радиуса. Во 2 главе выполнен анализ представлений о химической связи и гибридизации электронных орбиталей с позиций перекрывания не электронных плотностей, а вакантных мест во внешней кольцегранной электронной оболочке атомов при формировании молекул из них. С этих позиций охарактеризованы атомы элементов таблицы Менделеева. В 3 главе рассмотрен разработанный и реализованный в программе Molecular Сonstructor (МС) геометрический алгоритм расчета координат центров атомов в моделях протеиногенных аминокислот. Введены понятия ротамерии пептидной связи между аминокислотными остатками и структурного полипептидного шаблона белка. Результаты модельных экспериментов показали, что повторение R, 0 или L-ротамеров пептидной связи обусловливает формирование правых, левых (поворотов) и β-спиралей. Мы их интерпретируем в качестве прототипов соответствующих конформеров вторичной структуры в белках. 4 глава посвящена способу кодирования и механизму декодирования информации о структурном шаблоне белка в геноме. А именно приведен статистический анализ экспериментальных данных в пользу специфического детерминирования в геноме конформеров вторичной структуры и шаблона пространственной структуры белка, согласно предложенной таблице генетического кода структурного шаблона белка. Обсуждается заявленная гипотеза о перекодировании информации третьего нуклеотида кодонов в ротамер пептидной связи непосредственно 3D-структурой изоакцепторных адапторных РНК к синонимичным кодонам. В последней 5 главе кратко изложены современные представления о фолдинге белка и охарактеризованы структурные шаблоны 100 белков из базы PDB, декодированные в программах Molecular Constructor и Picotech.


          https://img-fotki.yandex.ru/get/6406/158289418.20f/0_129776_c915bdf6_orig.pnghttps://img-fotki.yandex.ru/get/3013/158289418.20f/0_129777_5d138e11_orig.png



          Стр 110-111

          https://img-fotki.yandex.ru/get/9803/158289418.20f/0_129778_35eeac24_orig.png


          Стр. 146-147


          https://img-fotki.yandex.ru/get/6523/158289418.20f/0_129781_c3f9d563_orig.pnghttps://img-fotki.yandex.ru/get/6831/158289418.20f/0_129784_393caf0d_orig.pnghttps://img-fotki.yandex.ru/get/4135/158289418.210/0_129785_9c346658_orig.png




          НОВИЗНА ИДЕЙ ИЛИ ПОСЛЕСЛОВИЕ


          1. Впервые продемонстрирован алгоритм моделирования 3D-геометрии атомов и молекул на основе кольцегранной модели атома и её апроксимации телами Архимеда. Представлен метод расчета атомных радиусов атомов элементов таблицы Менделеева исходя из экспериментальных значений их ковалентных радиусов с учётом геометрии электронной поверхности.
          2. Заново переосмыслено понятие химической связи: перекрывание вакантных мест (а не электронной плотности) внешних электронных кольцегранных оболочек взаимодействующих атомов, что приводит к их реальному сближению и снижению электронной плотности между атомами в молекуле, сопровождающееся уменьшением общей энергии системы и напряжения в ней.
          3. Введено понятие о R (right)-, 0 (zero)- и L (left)-ротамеров пептидной связи, которые различаются между собой поворотом на угол кратный 120о.
          4. Статистически обосновано кодирование ротамеров пептидной связи, фрагментов вторичной структуры и структурных шаблонов белков в целом в геноме эукариот. Представлена таблица генетического кода структурного шаблона белка.
          5. Сформулирована гипотеза о перекодировании информации третьего нуклеотида кодонов в соответствующий ротамер пептидной связи непосредственно самой 3D-структурой изоакцепторной тРНК, а точнее углом поворота её акцепторного стебля вокруг своей оси. 
          6. Математический анализ сопряженности значений углов φ и ψ (карта Рамачандрана) для вторичных структур позволил обнаружить период их изменения в 120о при переходе от одной вторичной структуры к другой и предложить возможный механизм посттрансляционного фолдинга белка.
          7. Разработаны две авторские программы декодирования структурного шаблона белка Molecular Constructor и Picotech.


          АВТОРСКИЕ ПУБЛИКАЦИИ


          1. Соколик В.В. Кодирование вторичной структуры и структурного шаблона белка в геноме эукариот / НАУЧНЫЙ ФОНД "БИОЛОГ", Ежемесячный научный журнал. – 2014. – № 3. – С. 73-76.
          2. Соколик В.В. Никакой дополнительной информации, большей, чем та, что содержится в ДНК, для сворачивания белка не требуется / Ukr. Biochem. J., 2014. – 86, 5 (Suppl. 1) Матеріали ХІ Укріїнського біохімічного конгресу (06-10 жовтня 2014), Київ, c. 37-38.
          3. Соколик В.В. Предсказание пространственной структуры белка in silico на основе информации генома и геометрического алгоритма – альтернатива квантово-механическому подходу / Материалы Международной научной конференции «Математическое и компьютерное моделирование в биологии и химии. Перспективы развития» (28-30 мая 2012), Казань. – 2012. – С.155-158.
          4. Соколик В.В. Геометрия аминокислот / Материалы XV Международной научно-практической конференции «Наука и современность – 2012» (НС-15), (14 марта 2012), Новосибирск. – 2012. – С. 13-18.
          5. Кушелев А.Ю., Соколик В.В. Пикотехнология – новый подход в моделировании пространственной структуры белка / Заочная Международная научно-практическая конференция «Современная наука: тенденции развития» (24 января 2012), Краснодар: НИЦ Априори. – 2012. – С.203-207.
          6. Соколик В.В. Загадка изоакцепторных тРНК / Материалы II Всероссийской Интернет-Конференции «Актуальные проблемы биохимии и бионанотехнологии» (15-18 ноября 2011), Казань, Россия. – С. 11-15.
          7. Соколик В.В. Кодирование торсинного угла ω пептидной связи в белке / IV Международная конфер. "Актуальные проблемы биологии, нанотехнологий и медицины". (22-25 сентября 2011), Ростов-на-Дону. – С. 60-61.
          8. Sokolik V.V. Protein is coded in genome and synthesized in ribosomes as a structural template of a rotameric version sequence of peptide bound configuration / The International Moscow Conference on Computational Molecular Biology, МССМВ-11 (July 21-24, 2011), Moscow, Russia. – P. 347-348.
          9. Соколик В.В. Карта Рамачандрана: ротамерия пептидной связи и фолдинг белка / Материалы VII Международной научно-технической конференции «Актуальні питання біологічної фізики і хімії». Тезисы докладов БФФХ-2011 (26-30 апреля 2011 г.), Севастополь.– С.137-139.
          10. Sokolik V.V. Algorithm of protein structural template decoding according to its determined nucleotide sequence / Fist International Conference “Fundamental Medicine: From Scalpel Toward Genome, Proteome and Lipidome” (April 25-28, 2011), Pax Grid Virtual Conferences, Kazan, Russia. – P. 117-119.
          11. Соколик В.В. Ротамерные варианты конфигурации пептидной связи и их кодирование в геноме / Матеріали X Українського біохімічного з’їзду. Тези доповідей (13—17 вересня 2010 р.), Одеса. – С. 105-106.
          12. Соколик В.В. Способ моделирования пространственной структуры белка по детерминирующей его нуклеотидной последовательности // Біофізичний вісник. – 2010. - Вип. 24 (1). – С. 31-45.
          13. Sokolik V.V. Modeling of the individual structural template of protein on determining it nucleotide sequences / Материалы VII Международной конференции по биоинформатике, регуляции и структуры геномов и системной биологии (BGRS\SB-2010). Тезисы докладов (20-27 июня 2010 г.), Новосибирск. – С. 275.
          14. Соколик В.В. Пространственная структура гомологов основного актина и α-актина 1 различна / Сборник материалов I Международной научно-практической конференции «Наука и современность – 2010» в 3-х частях / Под общ. ред. С.С. Чернова - Новосибирск: «СИБПРИНТ», 2010. – 278 с. Ч. 1, С. 41-46.
          15. Соколик В.В. Моделирование пространственной структуры белка по детерминирующей его нуклеотидной последовательности / Материалы VI Международной научно-технической конференции «Актуальні питання теоретичної і прикладної біофізики, фізики і хімії». Тезисы докладов БФФХ-2010 (26-30 апреля 2010 г.), T.1, Севастополь.– С.201-204.
          16. Кушелев А.Ю., Полищук С.Е., Неделько Е.В. и др. Построение масштабной модели структуры белка // Актуальные проблемы современной науки. – 2002. – №2. – С. 236-243
          17. Кушелев А., Полищук С., Писаржевский С. Формы, механизмы, энергия наномира: Доступна ли энергия эфира для космических полётов? // Электроника: Наука, Технология, Бизнес. – 2002. – № 6. – С.72–76.
          18. Кушелев А.Ю., Соколик В.В. http://www.nanoworld.org.ru/.


          Принимаются предложения по распространению электронного тиража учебника "Пикотехнология белков" и перевод на английский язык для распространения учебника среди англоязычных читателей.

          Обсуждение