Сайт создан на платформе Nethouse. Хотите такой же?
Владельцу сайта

3D стркутуры Пикотехнологии, построенные по геометрическому алгоритму

vtvtvtv

ngngng
vxvxv

https://www.ncbi.nlm.nih.gov/protein/97 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/973106333

KUK63703

>ENA|KUK63703|
ttgggttcaggtacaaacgccagcaccctttctgaaactgttactgttactgttactgtt
actgttactgttactgttactgttactgtta ctgttactgttactgttactgttactgt
tattatataa

https://img-fotki.yandex.ru/get/94189/158289418.3e3/0_176b26_1f5e86bb_orig.png

https://img-fotki.yandex.ru/get/176508/158289418.3e3/0_176b49_61ac4e78_orig.gif

https://img-fotki.yandex.ru/get/195125/158289418.3e3/0_176b4a_3201ca6a_XL.png

https://img-fotki.yandex.ru/get/169608/158289418.3e3/0_176b4c_f058f2ed_XL.png


***
https://www.ncbi.nlm.nih.gov/protein/10 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/1095318419

SEK15922

>ENA|SEK15922|
gtgcagaggcatgggcagacgcccaagatatcctcccagcagctctctgggccagtcatc
gccaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcacc
gtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcgactttgccatgccattgccg
gcaaccggtcattgcacttga

https://img-fotki.yandex.ru/get/42692/158289418.3e3/0_176b28_33431273_orig.png

https://img-fotki.yandex.ru/get/58675/158289418.3e3/0_176b4d_5f5ee0c4_orig.gif

https://img-fotki.yandex.ru/get/174613/158289418.3e3/0_176b4e_fe8dbf4e_XL.png

***
https://www.ncbi.nlm.nih.gov/protein/68 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/682348964

KFY41221

>ENA|KFY41221|
aaactttttacgtctataatatcccctttaccgtacgtcaccgtcaccgtcaccgtcacc
gtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcacc
gtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcacc
gtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccccccagccagcc
gtggcgcatgtccacacatga

https://img-fotki.yandex.ru/get/176508/158289418.3e3/0_176b25_3cb175bb_orig.png

https://img-fotki.yandex.ru/get/169608/158289418.3e3/0_176b50_c939ebf2_orig.gif

https://img-fotki.yandex.ru/get/169608/158289418.3e3/0_176b4f_b6137aca_XL.png

***
https://www.ncbi.nlm.nih.gov/protein/10 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/1028550392

OAJ20702

>ENA|OAJ20702|
atgagcaggtcgttgagacaacctctgttcccaacacccacgctcgcatttcaagatgca
caagtaagtgtctggctcattgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtc
accgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtc
accgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcntaagtgtttctcttgcc
ctcatcgcccagccttgtcgacacgacttcacactcgttctcactgttcgctga

https://img-fotki.yandex.ru/get/52085/158289418.3e3/0_176b27_4eeef3bb_orig.png


***
https://www.ncbi.nlm.nih.gov/protein/92 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/929747320

XP_014148644

>ENA|XP_014148644|
atgggacctcagaggctcagactcacagccacagccacagtcacagtcacagtcacagcc
acagtcacagtcacagtcacagtcacagtcacagtcacagtcacagtcacagtcacagtc
acagtcacagtcacagtcacagttacagtcccagtcacagacactagtagaggactagag
tctcagactccctcagagtctcagatgcagaactgcggcgaagggagacggtcgagaaag
cctcacgcaggagagtgtctaagactcttagtgggtgggggtcacagactgagacagcct
gacaagtga

https://img-fotki.yandex.ru/get/94189/158289418.3e3/0_176b29_282b6f3d_orig.png

https://img-fotki.yandex.ru/get/4526/158289418.3e3/0_176b51_bab21693_orig.gif

https://img-fotki.yandex.ru/get/177849/158289418.3e3/0_176b52_b3e29e7_XL.png

https://img-fotki.yandex.ru/get/28874/158289418.3e3/0_176b53_156f742c_XL.png

https://img-fotki.yandex.ru/get/244791/158289418.3e3/0_176b54_7b8ee6c7_XL.png

https://img-fotki.yandex.ru/get/93500/158289418.3e3/0_176b55_4f0dcfaf_XL.png

Полный комплект файлов: https://cloud.mail.ru/public/2rbQ/1taz9qHr9


    Формы, механизмы, энергия наномира. Сообщение 86 601

    Готовится 597-ой выпуск рассылки "Новости лаборатории Наномир"

    http://subscribe.ru/catalog/science.news.nanoworldnews

    Дайджест:

    597 Открыты 23232(AGAGA)- и 12121-спирали Кушелева
    Классические антигомологи барназа / barnase и биназа / binase
    34343(Q-спираль) и 14141(QVQVQ-спираль) в
    Thioalkalivibrio nitratireducens DSM 14787 protein

    https://img-fotki.yandex.ru/get/243369/158289418.3e2/0_1768db_58a9b35c_orig.png

    https://img-fotki.yandex.ru/get/197807/158289418.3e2/0_1768ca_48de53bd_XL.png

    https://img-fotki.yandex.ru/get/166206/158289418.3e2/0_1768da_e2b18a23_orig.gif

    https://img-fotki.yandex.ru/get/174613/158289418.3e3/0_176a89_e156d2be_XL.png

    https://img-fotki.yandex.ru/get/30752/158289418.3e3/0_176a88_51407844_orig.gif

    https://img-fotki.yandex.ru/get/55828/158289418.3e3/0_176a8e_a93244e3_XL.png

    https://img-fotki.yandex.ru/get/197756/158289418.3e3/0_176a90_e00cc5d2_XL.png

    https://img-fotki.yandex.ru/get/52127/158289418.3e3/0_176a8c_f8137db4_orig.gif

    Полный комплект файлов: https://cloud.mail.ru/public/2rbQ/1taz9qHr9


    Формы, механизмы, энергия наномира. Сообщение 86 627

    Пикотехнология белков, ДНК, РНК - 2

    https://www.ncbi.nlm.nih.gov/protein/30 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/308220123

    >ENA|HM444113|HM444113.1 Mnemiopsis leidyi SIX class homeobox transcription factor SIX13c (SIX13c) mRNA, partial cds

    https://img-fotki.yandex.ru/get/244791/158289418.3e4/0_176c67_863ce06_orig.png

    ***
    https://www.ncbi.nlm.nih.gov/protein/81 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/814601875

    >ENA|KKF96471|

    https://img-fotki.yandex.ru/get/176508/158289418.3e4/0_176c68_8d3dbc66_orig.png
    ***
    https://www.ncbi.nlm.nih.gov/protein/11 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/1111466951

    >ENA|CVL09568|

    https://img-fotki.yandex.ru/get/198026/158289418.3e4/0_176c65_4566d600_orig.png

    ***
    https://www.ncbi.nlm.nih.gov/protein/60 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/602736179

    >ENA|EYT97105|

    https://img-fotki.yandex.ru/get/112407/158289418.3e4/0_176c66_708ca558_orig.png
    ***
    https://www.ncbi.nlm.nih.gov/protein/10 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/1020702258

    >ENA|KZM22758|

    https://img-fotki.yandex.ru/get/111568/158289418.3e4/0_176c69_d16a6e31_orig.png
    ***
    https://www.ncbi.nlm.nih.gov/protein/14 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/147765387

    >ENA|CAN76050|

    https://img-fotki.yandex.ru/get/216168/158289418.3e4/0_176c64_22f5b363_orig.png



      Создан новый стандарт вторичной структуры белка!

      https://img-fotki.yandex.ru/get/108697/158289418.3e4/0_176cab_41977475_XL.png
       http://nanoworld.org.ru/post/85732/#p85732


        Locus KKF96471
        Глядя на схему вторичной структуры легко заметить терминирующие кодоны, которые встречаются после 500-го аминокислотного остатка: https://img-fotki.yandex.ru/get/176508/ … 6_orig.png

        Поэтому 3D модель в действительности состоит из нескольких отдельных моделей разных белковых молекул.

        https://img-fotki.yandex.ru/get/198361/158289418.3e4/0_176cf8_9d1316d5_XL.png

        https://img-fotki.yandex.ru/get/94189/158289418.3e4/0_176cf9_f8e17728_XL.png

        https://img-fotki.yandex.ru/get/244791/158289418.3e4/0_176cf6_3450511d_orig.gif


          Q-спираль (13131-спираль) Кушелева длиной более 200 аминокислотных остатков:

          >ENA|CVL09568|
          https://img-fotki.yandex.ru/get/198026/158289418.3e4/0_176c65_4566d600_orig.png

          https://img-fotki.yandex.ru/get/30536/158289418.3e4/0_176d06_aae8cb52_orig.gif

          https://img-fotki.yandex.ru/get/226123/158289418.3e4/0_176d07_db0043b_XL.png

          https://img-fotki.yandex.ru/get/196365/158289418.3e4/0_176d08_a81c1ffb_XL.png

          https://img-fotki.yandex.ru/get/195431/158289418.3e4/0_176d09_d60bc7c5_XL.png

          https://img-fotki.yandex.ru/get/169883/158289418.3e4/0_176d0a_12fe5ea6_XL.png

          https://img-fotki.yandex.ru/get/52790/158289418.3e4/0_176d0b_1e8c03ad_XL.png

          https://img-fotki.yandex.ru/get/57797/158289418.3e4/0_176d0c_8a39a920_XL.png

          https://img-fotki.yandex.ru/get/228104/158289418.3e4/0_176d0d_aadcf5bd_XL.png

          https://img-fotki.yandex.ru/get/195431/158289418.3e4/0_176d0e_af4417e_XL.png

          https://img-fotki.yandex.ru/get/196183/158289418.3e4/0_176d0f_119a0535_XL.png

          https://img-fotki.yandex.ru/get/30894/158289418.3e4/0_176d10_7aef9c77_XL.png

          https://img-fotki.yandex.ru/get/246231/158289418.3e4/0_176d11_685d4236_XL.png
          Q-спираль по существу является реактором, состоящим из атомов азота...




          https://www.ncbi.nlm.nih.gov/protein/30 … DGPB4AU01R

          https://www.ncbi.nlm.nih.gov/nuccore/308220123

          >ENA|HM444113|HM444113.1 Mnemiopsis leidyi SIX class homeobox transcription factor SIX13c (SIX13c) mRNA, partial cds

          https://img-fotki.yandex.ru/get/244791/158289418.3e4/0_176c67_863ce06_orig.png

          https://img-fotki.yandex.ru/get/225029/158289418.3e4/0_176d97_196ead69_XL.png

          https://img-fotki.yandex.ru/get/169451/158289418.3e4/0_176d98_c1506b98_XL.png

          https://img-fotki.yandex.ru/get/196161/158289418.3e4/0_176d99_edf81e6d_XL.png

          https://img-fotki.yandex.ru/get/60436/158289418.3e4/0_176d9b_9f79a15b_XL.png

          https://img-fotki.yandex.ru/get/42692/158289418.3e4/0_176d9c_e263724d_XL.png

          https://img-fotki.yandex.ru/get/169451/158289418.3e4/0_176d9d_aa817459_XL.png


          https://www.ncbi.nlm.nih.gov/protein/60 … DGPB4AU01R

          https://www.ncbi.nlm.nih.gov/nuccore/602736179

          >ENA|EYT97105|

          Схема вторичной структуры: https://img-fotki.yandex.ru/get/112407/ … 8_orig.png

          На схеме вторичной структуры мы видим терминирующие кодоны. Значит в 3D модели представлено несколько отдельных белковых молекул.

          https://img-fotki.yandex.ru/get/109878/158289418.3e4/0_176dc1_ef9cfd1d_XL.png

          https://img-fotki.yandex.ru/get/9116/158289418.3e4/0_176dc2_ba7df904_XL.png

          https://img-fotki.yandex.ru/get/197807/158289418.3e4/0_176dc3_a58ff018_XL.png

          https://img-fotki.yandex.ru/get/105284/158289418.3e4/0_176dc4_b6415408_XL.png

          https://img-fotki.yandex.ru/get/48807/158289418.3e5/0_176dc5_395b486d_XL.png

          https://img-fotki.yandex.ru/get/9116/158289418.3e5/0_176dc6_6b0b4f76_XL.png
          Похоже, что это вообще другая молекула. Тут нет ни длинной 13131-спирали, ни других признаков, соответствующих вторичной структуре белка EYT97105. Это модели других белковых молекул...


          Формы, механизмы, энергия наномира. Сообщение 86 655

          Пикотехнология белков, ДНК, РНК - 2

          https://www.ncbi.nlm.nih.gov/protein/10 … DGPB4AU01R

          https://www.ncbi.nlm.nih.gov/nuccore/1020702258

          >ENA|KZM22758|

          Схема вторичной структуры: https://img-fotki.yandex.ru/get/111568/ … 1_orig.png

          На схеме вторичной структуры мы видим новую программную спираль:

          https://img-fotki.yandex.ru/get/58784/158289418.3e5/0_176dc7_259400cd_XL.png

          352352-, которая переходит в программную спираль 233233- и далее, в нерегулярную структуру. При этом на протяжении всего участка сохраняется музыкальный размер и периодичность первичной структуры LPG-

          Интересно было бы вычленить эту 3D-подструктуру из полной модели белковой молекулы.

          Полная модель:

          https://img-fotki.yandex.ru/get/50388/158289418.3e5/0_176dc8_c924e4dc_XL.png

          https://img-fotki.yandex.ru/get/166206/158289418.3e5/0_176dc9_7969a735_XL.png

          https://img-fotki.yandex.ru/get/94189/158289418.3e5/0_176dca_3aae89df_XL.png

          https://img-fotki.yandex.ru/get/62701/158289418.3e5/0_176dcb_5f09dc65_XL.png

          https://img-fotki.yandex.ru/get/120031/158289418.3e5/0_176dcc_c316f777_XL.png

          https://img-fotki.yandex.ru/get/58784/158289418.3e5/0_176dcd_ed22e2ea_XL.png

          https://img-fotki.yandex.ru/get/152444/158289418.3e5/0_176dce_c5f57d42_XL.png

          А теперь посмотрим модель фрагмента:

          Locus KZM22758
          FT   CDS 757..837

          https://img-fotki.yandex.ru/get/194425/158289418.3e5/0_176dcf_883f71c6_orig.gif

          https://img-fotki.yandex.ru/get/122076/158289418.3e5/0_176dd0_2e5ca4bb_XL.png

          https://img-fotki.yandex.ru/get/172272/158289418.3e5/0_176dd1_e795a492_XL.png

          https://img-fotki.yandex.ru/get/48807/158289418.3e5/0_176dd2_c9afefa_XL.png


          Интересно, зачем нужно сохранение музыкального размера при переходе одной программной спирали в другую? Хотя ... музыкальный размер как раз не сохраняется. Сохраняется только высота нот.