Сайт создан на платформе Nethouse. Хотите такой же?
Владельцу сайта

2D диаграммы Пикотех некоторых белковых структур из базы NCBI

1. 

https://www.ncbi.nlm.nih.gov/Structure/ … p;uid=5TUD

Structural insights into the extracellular recognition of the human serotonin 2B receptor by an antibody

Ishchenko A, Wacker D, Kapoor M, Zhang A, Han GW, Basu S, Patel N, Messerschmidt M, Weierstall U, Liu W, Katritch V, Roth BL, Stevens RC, Cherezov V

https://img-fotki.yandex.ru/get/880375/249950893.0/0_16a3b7_7315a46a_orig.png

https://www.ebi.ac.uk/ena/data/view/CAA … play=fasta

>ENA|CAA54513|CAA54513.1 Homo sapiens (human) 5-HT2B serotonin receptor 
ATGGCTCTCTCTTACAGAGTGTCTGAACTTCAAAGCACAATTCCTGAGCACATTTTGCAG
AGCACCTTTGTTCACGTTATCTCTTCTAACTGGTCTGGATTACAGACAGAATCAATACCA
GAGGAAATGAAACAGATTGTTGAGGAACAGGGAAATAAACTGCACTGGGCAGCTCTTCTG
ATACTCATGGTGATAATACCCACAATTGGTGGAAATACCCTTGTTATTCTGGCTGTTTCA
CTGGAGAAGAAGCTGCAGTATGCTACTAATTACTTTCTAATGTCCTTGGCGGTGGCTGAT
TTGCTGGTTGGATTGTTTGTGATGCCAATTGCCCTCTTGACAATAATGTTTGAGGCTATG
TGGCCCCTCCCACTTGTTCTATGTCCTGCCTGGTTATTTCTTGACGTTCTCTTTTCAACC
GCATCCATCATGCATCTCTGTGCCATTTCAGTGGATCGTTACATAGCCATCAAAAAGCCA
ATCCAGGCCAATCAATATAACTCACGGGCTACAGCATTCATCAAGATTACAGTGGTGTGG
TTAATTTCAATAGGCATTGCCATTCCAGTCCCTATTAAAGGGATAGAGACTGATGTGGAC
AACCCAAACAATATCACTTGTGTGCTGACAAAGGAACGTTTTGGCGATTTCATGCTCTTT
GGCTCACTGGCTGCCTTCTTCACACCTCTTGCAATTATGATTGTCACCTACTTTCTCACT
ATCCATGCTTTACAGAAGAAGGCTTACTTAGTCAAAAACAAGCCACCTCAACGCCTAACA
TGGTTGACTGTGTCTACAGTTTTCCAAAGGGATGAAACACCTTGCTCGTCACCGGAAAAG
GTGGCAATGCTGGATGGTTCTCGAAAGGACAAGGCTCTGCCCAACTCAGGTGATGAAACA
CTTATGCGAAGAACATCCACAATTGGGAAAAAGTCAGTGCAGACCATTTCCAACGAACAG
AGAGCCTCAAAGGTCCTAGGGATTGTGTTTTTCCTCTTTTTGCTTATGTGGTGTCCCTTC
TTTATTACAAATATAACTTTAGTTTTATGTGATTCCTGTAACCAAACTACTCTCCAAATG
CTCCTGGAGATATTTGTGTGGATAGGCTATGTTTCCTCAGGAGTGAATCCTTTGGTCTAC
ACCCTCTTCAATAAGACATTTCGGGATGCATTTGGCCGATATATCACCTGCAATTACCGG
GCCACAAAGTCAGTAAAAACTCTCAGAAAACGCTCCAGTAAGATCTACTTCCGGAATCCA
ATGGCAGAGAACTCTAAGTTTTTCAAGAAACATGGAATTCGAAATGGGATTAACCCTGCC
ATGTACCAGAGTCCAATGAGGCTCCGAAGTTCAACCATTCAGTCTTCATCAATCATTCTA
CTAGATACGCTTCTCCTCACTGAAAATGAAGGTGACAAAACTGAAGAGCAAGTTAGTTAT
GTATAG

http://nanoworld.org.ru/post/96477/#p96477
Программа Пикотех показывает следующую детализированную структуру.
Вторичная структура белка начинается с программной 35-спирали длиной 8 аминокислотных остатков. 8-ой остаток Ser является последним остатком программной 35-спирали и первым остатком пи-спирали, которая состоит из 4-х аминокислотных остатков. Далее идёт последовательность композиционных кодов 5233553, а за ней один виток альфа-спирали: 1111, образованный аминокислотными остатками LQST. Остатки SIP под номерами 38,39,40 образуют виток бета-спирали. Затем последовательность EEMKQI образует примерно половину витка программной 35-спирали. Остатки с 81 по 86 образуют гибридную альфа-310-спираль. Далее 87-90 идет пи-спираль. 94-98 - 310-спираль (полтора витка). 120-123 - один виток альфа-спирали. Участок 124-334 структурирован одиночными композиционными кодами всех типов. 335-341 - программная 355-спираль. 342-346 - программная 23-спираль. 346-351 - пи-спираль (примерно полтора витка). 360-363 - один виток 310-альфа-спирали. 378-383 - прямая альфа-спираль (полтора витка). 414-418 - альфа-310-спираль (примерно 1.3 витка).
431-435 - программная 23-спираль. 440-443 - гнутая метионином альфа-спираль (примерно 1.2 витка). 467-471 пи-спираль (примерно 1.2 витка). 469-480 - программная 3335-спираль.

https://img-fotki.yandex.ru/get/893753/249950893.1/0_16aff1_b0049741_orig.png

https://img-fotki.yandex.ru/get/510105/249950893.1/0_16aff0_89b162aa_orig.png









2. 
https://www.ncbi.nlm.nih.gov/Structure/pdb/5V56

Crystal structure of a multi-domain human smoothened receptor in complex with a super stabilizing ligand

Zhang X, Zhao F, Wu Y, Yang J, Han GW, Zhao S, Ishchenko A, Ye L, Lin X, Ding K, Dharmarajan V, Griffin PR, Gati C, Nelson G, Hunter MS, Hanson MA, Cherezov V, Stevens RC, Tan W, Tao H, Xu F

https://img-fotki.yandex.ru/get/896238/249950893.1/0_16afce_af6cf2b8_orig.png

http://www.rcsb.org/pdb/explore/explore … ureId=5V56
https://www.ebi.ac.uk/ena/data/view/AAA … play=fasta

>ENA|AAA23367|AAA23367.1 Desulfovibrio vulgaris hypothetical protein 
ATGCCCAAAGCCCTCATCGTCTACGGTTCCACCACAGGCAACACGGAATACACCGCCGAA
ACCATCGCACGTGAACTTGCCGATGCAGGGTACGAAGTCGATAGCCGGGACGCGGCCTCT
GTCGAGGCTGGCGGTCTCTTCGAAGGCTTCGACCTCGTCCTTCTCGGATGCTCGACGTGG
GGTGACGACTCCATCGAACTGCAGGACGACTTCATTCCCCTTTTCGACTCCCTCGAAGAG
ACGGGGGCGCAGGGCCGCAAGGTGGCCTGCTTCGGCTGCGGCGACAGTTCCTACGAGTAC
TTCTGCGGGGCTGTCGACGCCATCGAAGAGAAGCTCAAGAACCTCGGTGCCGAAATCGTT
CAGGACGGTCTTCGCATCGATGGCGACCCCCGCGCCGCCCGGGACGACATCGTCGGCTGG
GCGCATGACGTGAGGGGCGCCATCTAG

http://nanoworld.org.ru/post/96494/#p96494
Результаты программы Пикотех

4-8 - альфа-спираль
49-53 - альфа-спираль
57-60 - альфа-спираль
62-65 - альфа-спираль
67-71 - альфа-спираль
75-78 - альфа-спираль
80-95 - альфа-спираль
97-103 - альфа-спираль
105-108 - альфа-спираль
110-115 - альфа-спираль
115-121 - программная 35-спираль
120-127 - программная 3355-спираль
128-141 - альфа-спираль
143-148 - альфа-спираль

https://img-fotki.yandex.ru/get/877700/249950893.1/0_16afc9_75560fe6_orig.png

https://img-fotki.yandex.ru/get/477847/249950893.1/0_16afeb_a12b3edb_orig.png










3.
https://www.ncbi.nlm.nih.gov/Structure/pdb/5W0P

Identification of Phosphorylation Codes for Arrestin Recruitment by G Protein-Coupled Receptors

Zhou XE, He Y, de Waal PW, Gao X, Kang Y, Van Eps N, Yin Y, Pal K, Goswami D, White TA, Barty A, Latorraca NR, Chapman HN, Hubbell WL, Dror RO, Stevens RC, Cherezov V, Gurevich VV, Griffin PR, Ernst OP, Melcher K, Xu HE

https://img-fotki.yandex.ru/get/476913/249950893.0/0_16a3b9_61f34840_orig.png

https://www.ebi.ac.uk/ena/data/view/CAD … play=fasta

>ENA|CAD97623|CAD97623.1 Homo sapiens (human) hypothetical protein 
ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTA
CGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTG
GCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTAC
GTCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCC
GTGGCTGACCTCTTCATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCAT
GGATACTTCGTCTTCGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGC
GGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGT
AAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATGGGCGTTGCCTTCACC
TGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAGGTACATCCCC
GAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAAC
GAGTCTTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTT
TTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAGGCCGCTGCCCAGCAGCAGGAGTCA
GCCACCACACAGAAGGCAGAGAAGGAGGTCACCCGCATGGTCATCATCATGGTCATCGCT
TTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGC
TCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCCAAGAGCGCCGCCATC
TACAACCCTGTCATCTATATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCACCACC
ATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACG
GAGACGAGCCAGGTGGCCCCGGCCTAA

http://nanoworld.org.ru/post/96490/#p96490
Программа Пикотех показывает

8-14 - альфа-спираль.
21-26 - альфа-спираль.
28-31 - альфа-спираль.
35-44 - альфа-спираль.
46-70 - 310-альфа-спираль.
72-78 - альфа-спираль.
83-87 - альфа-спираль.
90-97 - альфа-спираль.
102-107 - альфа-спираль.
112-115 - альфа-спираль.
117-120 - альфа-спираль.
124-139 - альфа-спираль.
141-151 - альфа-спираль.
153-156 - альфа-спираль.
158-168 - альфа-спираль.
172-186 - альфа-спираль.
189-201 - альфа-спираль.
204-216 - альфа-спираль.
215-225 - программная 355-спираль.
224-233 - альфа-спираль.
235-239 - альфа-спираль.
238-248 - программная 255-спираль.
247-259 - альфа-спираль.
261-271 - альфа-спираль.
273-283 - альфа-спираль.
285-290 - альфа-спираль.
295-302 - альфа-спираль.
307-326 - альфа-спираль.
336-348 - альфа-спираль.

https://img-fotki.yandex.ru/get/516062/249950893.1/0_16afec_886d280e_orig.png

https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcc_519f9d05_orig.png













4.
https://www.ncbi.nlm.nih.gov/Structure/pdb/5XEZ

Structure of the full-length glucagon class B G-protein-coupled receptor

Zhang H, Qiao A, Yang D, Yang L, Dai A, de Graaf C, Reedtz-Runge S, Dharmarajan V, Zhang H, Han GW, Grant TD, Sierra RG, Weierstall U, Nelson G, Liu W, Wu Y, Ma L, Cai X, Lin G, Wu X, Geng Z, Dong Y, Song G, Griffin PR, Lau J, Cherezov V, Yang H, Hanson MA, Stevens RC, Zhao Q, Jiang H, Wang MW, Wu B

https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcd_1b4a76df_orig.png

http://www.rcsb.org/pdb/explore/explore … ureId=5XEZ
http://www.uniprot.org/uniprot/P47871
https://www.ebi.ac.uk/ena/data/view/AAC … play=fasta

>ENA|AAC52063|AAC52063.1 Homo sapiens (human) glucagon receptor 
ATGCCCCCCTGCCAGCCACAGCGACCCCTGCTGCTGTTGCTGCTGCTGCTGGCCTGCCAG
CCACAGGTCCCCTCCGCTCAGGTGATGGACTTCCTGTTTGAGAAGTGGAAGCTCTACGGT
GACCAGTGTCACCACAACCTGAGCCTGCTGCCCCCTCCCACGGAGCTGGTGTGCAACAGA
ACCTTCGACAAGTATTCCTGCTGGCCGGACACCCCCGCCAATACCACGGCCAACATCTCC
TGCCCCTGGTACCTGCCTTGGCACCACAAAGTGCAACACCGCTTCGTGTTCAAGAGATGC
GGGCCCGACGGTCAGTGGGTGCGTGGACCCCGGGGGCAGCCTTGGCGTGATGCCTCCCAG
TGCCAGATGGATGGCGAGGAGATTGAGGTCCAGAAGGAGGTGGCCAAGATGTACAGCAGC
TTCCAGGTGATGTACACAGTGGGCTACAGCCTGTCCCTGGGGGCGCTGCTCCTCGCCTTG
GCCATCCTGGGGGGCCTCAGCAAGCTGCACTGCACCCGCAATGCCATCCACGCGAATCTG
TTTGCGTCCTTCGTGCTGAAAGCCAGCTCCGTGCTGGTCATTGATGGGCTGCTCAGGACC
CGCTACAGCCAGAAAATTGGCGACGACCTCAGTGTCAGCACCTGGCTCAGTGATGGAGCG
GTGGCTGGCTGCCGTGTGGCCGCGGTGTTCATGCAATATGGCATCGTGGCCAACTACTGC
TGGCTGCTGGTGGAGGGCCTGTACCTGCACAACCTGCTGGGCCTGGCCACCCTCCCCGAG
AGGAGCTTCTTCAGCCTCTACCTGGGCATCGGCTGGGGTGCCCCCATGCTGTTCGTCGTC
CCCTGGGCAGTGGTCAAGTGTCTGTTCGAGAACGTCCAGTGCTGGACCAGCAATGACAAC
ATGGGCTTCTGGTGGATCCTGCGGTTCCCCGTCTTCCTGGCCATCCTGATCAACTTCTTC
ATCTTCGTCCGCATCGTTCAGCTGCTCGTGGCCAAGCTGCGGGCACGGCAGATGCACCAC
ACAGACTACAAGTTCCGGCTGGCCAAGTCCACGCTGACCCTCATCCCTCTGCTGGGCGTC
CACGAAGTGGTCTTCGCCTTCGTGACGGACGAGCACGCCCAGGGCACCCTGCGCTCCGCC
AAGCTCTTCTTCGACCTCTTCCTCAGCTCCTTCCAGGGCCTGCTGGTGGCTGTCCTCTAC
TGCTTCCTCAACAAGGAGGTGCAGTCGGAGCTGCGGCGGCGTTGGCACCGCTGGCGCCTG
GGCAAAGTGCTATGGGAGGAGCGGAACACCAGCAACCACAGGGCCTCATCTTCGCCCGGC
CACGGCCCTCCCAGCAAGGAGCTGCAGTTTGGGAGGGGTGGTGGCAGCCAGGATTCATCT
GCGGAGACCCCCTTGGCTGGTGGCCTCCCTAGATTGGCTGAGAGCCCCTTCTGA

http://nanoworld.org.ru/post/96505/#p96505
Программа Пикотех показывает

147-173 - наиболее протяженный участок альфа-310-спирали. 
Весь белок представлен преимущественно участками альфа-310-спиралей.

https://img-fotki.yandex.ru/get/509739/249950893.1/0_16b0a0_f8fd49ff_orig.png

https://img-fotki.yandex.ru/get/893904/249950893.1/0_16b0a1_6da31b90_orig.png










5.
https://www.ncbi.nlm.nih.gov/pubmed/17962520
https://www.ncbi.nlm.nih.gov/Structure/ … ;uid=60314

High-resolution crystal structure of an engineered human beta2-adrenergic G protein-coupled receptor.

Cherezov V1, Rosenbaum DM, Hanson MA, Rasmussen SG, Thian FS, Kobilka TS, Choi HJ, Kuhn P, Weis WI, Kobilka BK, Stevens RC.

https://img-fotki.yandex.ru/get/893240/249950893.0/0_16a3b1_d636e8c2_orig.png

https://www.rcsb.org/pdb/explore/explor … ureId=2RH1

https://img-fotki.yandex.ru/get/6713/249950893.1/0_16afcf_be7ab3f6_orig.png

http://www.uniprot.org/uniprot/P00720
https://www.ebi.ac.uk/ena/data/view/CAA28212

>ENA|CAA28212|CAA28212.1 Enterobacteria phage T4 hypothetical protein 
ATGAATATATTTGAAATGTTACGTATAGATGAACGTCTTAGACTTAAAATCTATAAAGAC
ACAGAAGGCTATTACACTATTGGCATCGGTCATTTGCTTACAAAAAGTCCATCACTTAAT
GCTGCTAAATCTGAATTAGATAAAGCTATTGGGCGTAATTGCAATGGTGTAATTACAAAA
GATGAGGCTGAAAAACTCTTTAATCAGGATGTTGATGCTGCTGTTCGCGGAATTCTGAGA
AATGCTAAATTAAAACCGGTTTATGATTCTCTTGATGCGGTTCGTCGCTGTGCATTGATT
AATATGGTTTTCCAAATGGGAGAAACCGGTGTGGCAGGATTTACTAACTCTTTACGTATG
CTTCAACAAAAACGCTGGGATGAAGCAGCAGTTAACTTAGCTAAAAGTATATGGTATAAT
CAAACACCTAATCGCGCAAAACGAGTCATTACAACGTTTAGAACTGGCACTTGGGACGCG
TATAAAAATCTATAA

https://img-fotki.yandex.ru/get/517809/249950893.1/0_16afd8_c591449d_orig.png

https://img-fotki.yandex.ru/get/768139/249950893.1/0_16afd9_74627b67_orig.png