Сайт создан на платформе Nethouse. Хотите такой же?
Владельцу сайта

Пикотехнология белков

В 1000 раз точнее и в 1 000 000 000 быстрее

 ренгено-структурного анализа 

Пространственная структура белка закодирована в его нуклеотидной посдовательности и определяется в соответствии с композиционным генетическим кодом

Получите точную пикоструктуру интересующего Вас белка через неделю

 Ваша заявка должна содержать лишь код интересующего Вас белка EMBL, либо мРНК для него


Уважаемые коллеги!


Приглашаем Вас к сотрудничеству по следующим направлениям.


СОЗДАНИЕ РАСШИРЕННОЙ ВЕРСИИ ПИКОТЕХНОЛОГИИ


Метод Пикотехнологии, основанный на открытии Композиционного генетического кода, бытро выдаёт точные, детальные и масштабируемые пространственные изображения белковых молекул.

Силами нескольких программистов создан  Online service PROTEIN PICOTECHNOLOGY

Стуктуры 2D Пикотех выполняются в автоматическом режиме. 
Структуры 3D Пикотех в зависимости от состава молекул выполняются либо в автоматическом (по геометрическому шаблону) либо в ручном режиме (с учётом физико-химических взаимодействий, а также свойств сустава Pro, являющихся ноу-хау Лаборатории Наномир). 
Фактически запрограммирована табличная функция "код-структура". Пространственная структура белка на уровне геометрического алгоритма тоже получается в первом приближении.

Создвание программного обеспечения для построения  структур 3D Пикотех - более сложная задача, требующая участия коллектива программистов.

Учитывая, что экономический эффект от создания полноценной системы "Пикотехнология 3D" трудно переоценить, хочу предложить Вам рассмотреть возможность решения этой грандиозной проблемы. 


ЭКСПЕРИМЕНТАЛЬНОЕ ОПРЕДЕЛЕНИЕ СТРУКТУР ПРОГРАММЫНЫХ СПИРАЛЕЙ МЕТОДОМ РСА


В лаборатории Наномир создана новая технология определения структуры белковых молекул, которая работает примерно в миллиард раз быстрее РСА. Наша задача - в кратчайшие сроки проверить новую технологию, т.к. от её внедрения человечество может получить фантастический эффект. Просим сообщить о возможности экспериментально выяснить структуры белков, приведённых ниже, методом рентгено-структурного анализа.


Предлагаем проверить Пикотехнолгию белков на простых структурах типа поливалина:


ETC64880: https://www.ncbi.nlm.nih.gov/nuccore/564568708

OXS06857: https://www.ncbi.nlm.nih.gov/nuccore/1226034760

KOF67455: https://www.ncbi.nlm.nih.gov/nuccore/918287724

OUM69688: https://www.ncbi.nlm.nih.gov/nuccore/1198313040

PIS11988: https://www.ncbi.nlm.nih.gov/nuccore/1277217132

KOF75295: https://www.ncbi.nlm.nih.gov/nuccore/918302080

OLP77457: https://www.ncbi.nlm.nih.gov/nuccore/1129165616

KYM86846: https://www.ncbi.nlm.nih.gov/nuccore/1009361734?&fmt_mask=65536

OTF86159: https://www.ncbi.nlm.nih.gov/nuccore/CM007906.1?report=fasta&sat=37&satkey=307832265&itemID=1362

KKF17324: https://www.ncbi.nlm.nih.gov/nuccore/808866584?&fmt_mask=65536

XP_002382247: https://www.ncbi.nlm.nih.gov/nuccore/238502026

OLP98873: https://www.ncbi.nlm.nih.gov/nuccore/1129194414

CDW76368: https://www.ncbi.nlm.nih.gov/nuccore/678335661

AHB99005: https://www.ncbi.nlm.nih.gov/nuccore/564747871?&fmt_mask=65536

OAQ27448: https://www.ncbi.nlm.nih.gov/nuccore/1032646064

OUM69730: https://www.ncbi.nlm.nih.gov/nuccore/1198313040

OGL53990: https://www.ncbi.nlm.nih.gov/nuccore/1084158629

EIE92391: https://www.ncbi.nlm.nih.gov/nuccore/76151980

XP_001590524: https://www.ncbi.nlm.nih.gov/nuccore/156049114

OTG33229: https://www.ncbi.nlm.nih.gov/nuccore/CM007891.1?from=7600734&to=7601591&sat=37&sat_key=307832447

OLQ06943: https://www.ncbi.nlm.nih.gov/nuccore/1129204435

XP_001895277: https://www.ncbi.nlm.nih.gov/nuccore/170580473

XP_001584576: https://www.ncbi.nlm.nih.gov/nuccore/156030497

KOF84884: https://www.ncbi.nlm.nih.gov/nuccore/918315370


https://img-fotki.yandex.ru/get/509292/158289418.4a7/0_186c5c_1ebe5075_XL.png


С уважением,
Александр Кушелев,
Руководитель Лаборатории Наномир.
+7 (903) 2003424
kushelev20120@yandex.ru

Skype  kushelev2009



Ежедневно в мире заказывается 60 структур белков методом РСА (рентгено-структурного анализа) по средней стоимости от 10 000 долларов и выше.  Срок изготовления заказа может длиться от полугода до 3-х лет.


Только 3% белков можно кристаллизовать, следовательно -  исследовать методом РСА.  


Метод Пикотехнологии распознаёт 1569 структур белков за 3 часа.


Самым предприимчивым пикотехнология белков принесет триллионы долларов.


Если удастся привлечь клиентов, чтобы они сделали пробные заказы за счёт Лаборатории Наномир, то новая технология очень быстро распространится по планете.


Ведь старая технология (рентгеноструктурный анализ) не может определить структуры 97% белков даже по триллиону долларов за штуку. А новая может выполнить первые 100 заказов даром.


Статьи

Резюме метода Пикотехнологии

Human Genome Protein Structure


На сегодняшний день Лабораторией Наномир по методу Пикотехнологии выполнена база белковых структур "Human Genome Protein", расположенная по этим адресам:

Part 1: https://cloud.mail.ru/public/BJeH/PdR6tFSsR

Part 2: https://cloud.mail.ru/public/Jxkq/Yt3GQAcC8

База содержит структуры всех белков человека, для которых известна нуклеотидная последовательность 

(24 хромосомы, 114 419 кодирующих нуклеотидных последовательностей).


Посмотрите выборочные примеры структур белков, кодируемых 1  23, 

3-14, 5, 78,  9, 101112, 13, 14, 16, 17, 18 20, 21, 22(Y) хромосомами человека, а также примеры некоторых других "монстров" хромосом по ссылке .


Всего у человека 24 хромосомы. Общее число белков около 5 000 000. 


С помощью рентгеноструктурного анализа за всю историю его существования, во всех странах вместе взятых смогли определить около 100 000 структур белка. И то - половина неправильно. Это обошлось заказчикам в миллиард долларов. 


Все белки человека рентген не покажет даже за триллион триллионов долларов -  только 3%, которые кристаллизуются.

Для их исследования методом РСА не хватит и миллиона лет.


Мы выполним точную пикоструктуру интересующего Вас белка за неделю.


Для исследователей разработана удобное графическое представление 2D и 3D структур Пикотех гигантских бековых молекул.


Ваша заявка должна содержать лишь код интересующего Вас белка из базы данных PDB, либо мРНК для него.




ПРЕАМБУЛА


В настоящее время одним из популярных алгоритмов моделирования пространственной структуры белка, который исходит из его аминокислотной последовательности, является способ построение модели по гомологии на основе общего структурного шаблона. 


Разработан новый способ моделирования структурного шаблона белка по детерминирующей его нуклеотидной последовательности, поскольку информация о топологии вторичной структуры белка и его индивидуальном  структурном шаблоне  содержится непосредственно в гене каждого белка. Эта информация может быть декодирована в соответствии с таблицей генетического кода структурного шаблона белка авторскими программами Пикотех (PT) и Молекулярный конструктор (МС) в виде координатного файла в pdb-формате. 


Важным достоинством метода является то, что можно построить структурный шаблон индивидуально для любого неизвестного белка лишь “прочитав” детерминирующую его нуклеотидную последовательность. Такой шаблон служит единой матрицей для пространственной структуры всех молекул данного белка в ходе посттрансляционного фолдинга in vivo и виртуального фолдинга или докинга in silico.


Модели белковых молекул в Пикотехнологии  предполагают наличие "жестких" кольцеобразных структур в электронных оболочках атомов, соединяющихся в многогранники. Это позволяет нам типологизировать формы участков белковых молекул и точно описать их в трехмерном изображении, с точностью до пикометра.


Структура 2D диаграммы Пикотех


СОКРАЩЁННАЯ ДИАГРАММА


Красный - альфа-спираль.
Оранжевый - 310-спираль.
Розовый - одиночный код альфа/310 спиралей.
Голубой - пи-спираль.
Зеленый - бета-спираль.
Сиреневый - метиониновая спираль. У неё более крупный шаг "резьбы", чем у обычной альфа-спирали.
Черный в сокращённом представлении и белый в развернутом означают либо неизвестный код, либо конец трансляции.
Циклическое повторение цветов - программная спираль.


http://img-fotki.yandex.ru/get/6210/126580004.53/0_bcc31_366c6e2c_S.gif http://img-fotki.yandex.ru/get/6304/126580004.53/0_bcc32_4f52ef7b_S.gif http://img-fotki.yandex.ru/get/6302/126580004.52/0_bcc2f_a96d98c5_S.gif http://img-fotki.yandex.ru/get/6307/126580004.52/0_bcc30_b4791ec4_S.gif
Альфа-спираль Бета-спираль Пи-спираль 310-спираль Метиониновая спираль


  

https://img-fotki.yandex.ru/get/898391/158289418.498/0_1859fc_e2e79c6_orig.png


ПОЛНАЯ ДИАГРАММА


Содержание столбцов


1 - порядковый номер аминокислотного остатка в белковой молекуле
2 - триплетный код
3 - однобуквенный код аминокислотного остатка
4 - трёхбуквенное обозначение аминокислотного остатка
5 - упрощённый композиционный код
6 - графическая интерпретация упрощенного композиционного кода
7 - композиционный код
8 - графическая интерпретация композиционного кода
9 - нота, которая звучит при установке данной аминокислоты в растущую белковую цепь
10 - графическое изображение ноты (или ударного инструмента)
Для новой версии Пикотех 2018 разработан Композиционный код 7var
https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae92_83cc91e_orig.jpg
Программные спирали - повторение последовательности композиций. Например, один код альфа-спирали, затем один код пи-спирали. n(35) задаёт программную спираль, а n3 или n5 - простые спирали (пи-спираль и альфа-310-спираль).
1111111111111111111 - прямая альфа-спираль
4444444444444444444 - прямая 310-спираль
3333333333333333333 - прямая пи-спираль
2222222222222222222 - прямая бета-спираль
232323 - программная 23-спираль
141414 - программная 14-спираль

Композиционный генетический код.


http://nanoworld.org.ru/post/94081/#p94081

https://img-fotki.yandex.ru/get/509063/158289418.498/0_1859fd_27b43600_orig.png



Триплеты ДНК кодируют аминокислоты. В упрощённом представлении третья буква триплета управляет углом поворота. Это показывают пикотехнологические 3D модели аминокислотных остатков. Один аминокислотный остаток можно повернуть относительно другого на углы 0, 120 и 240 градусов.  Для описания пространственных структур белковых молекул представлен Композиционный генетический код. 

Подробнее


Согласно методу Пикотехнологии, электрон имеет "скелет" в виде кольца диаметром типа 1.7 ангстрема (для внешних оболочек водорода, углерода, азота, кислорода). Кольцевые "скелеты" электронов формируют кольцегранные электронные оболочки и кольцевые механизмы молекул. Модели этих механизмов показывают, как складываются альфа-спираль, 310-спираль, смешанные альфа-310-спирали, пи-спирали и бета-спирали, которые оказались не по 2 остатка на виток.


Композиционный генетический код 4var, 6var и 7var


В Диграммах Пикотех применяются три вида композиционного генетического кода – коды 4var, 6var и 7var. 
Код "2" (спираль - не спираль).
Код 4var более подробный (альфа-, бета-, пи-, 310-).
Код 6var ещё более подробный. В нём есть различие "одиночный альфа-код", "код альфа-спирали", "код 310-спирали", "Код метионина в составе спирали". 
Код 7var  различает одиночный код пи-спирали от кода в составе пи-спирали .


В настоящее время считается, что белок в неопознанной части структур, полученных методом РСА, не имеет определенной структуры, но пикотехнология показала, что это не так. В программе "Пикотех" вся структура определена.


Пикотехнология не может определить структуры, полученные не по программе рибосомой. Если после сборки белка он обработан ферментами, например, разрезан и переделан, то программа "Пикотех" об этом не даёт информации.


Построение 2D Диаграмм и структур 3D Пикотех


Алгоритм построения Пикотехнологических моделей белков основан на открытии Композичионного генетического кода, см. монографию А.КУшелева и В.Соколик "Геометрия живого наномира. Пикотехнология белков". Структуры  2D Пикотех строятся с достоверностью 100% в автоматическом режиме.  Структуры 3D Пикотех  в зависимости от состава молекул строятся в автоматическом режиме (геометрический алгоритм) либо в ручном режиме (с учётом физико-химических взаимодействий и свойств сустава Pro). Метод построения структур 3D Пикотех на базе 2D структур Пикотех является ноу-хау Лабораторатории Наномир.


Примеры структур 2D и 3D Пикотех


Пикотехнологическая модель гистонного комплекса
http://nanoworld.org.ru/post/96354/#p96354

Пикотехнологические 2D и 3D модели длинных спиралей 

http://nanoworld.org.ru/topic/1837/ http://nanoworld.org.ru/post/91815/#p91815 , http://nanoworld.org.ru/topic/1656/page/5/ 

Три надежных метода проверки Пикотехнологии


Первый - достоверная корреляция с данными РСА. Конечно, РСА не даёт высокой достоверности, но она часто выше 50%.

На таких белках, как инсулин, гемоглобин, окситоцин корреляция приближается к 100%, т.к. в окситоцине, например, есть замкнутые циклы через дисульфидные мостики. Это позволяет проверить и РСА, и Пикотех.


Второй - замкнутые через дисульфидные мостики циклы типа окситоциновых. Вероятность случайного замыкания шести циклов, насчитывающих десятки аминокислотных остатков из разных окситоцинов, порядка 1/30 000 000 000. Речь идёт о вероятности для каждого цикла - все шесть могут случайно замкнуться с вероятностью (1/30 000 000 000)^6.


Третий - самоповерка на примере сверхдлинных базовых и программных спиралей, где наблюдается 100%-ная корреляция между вторичной и первичной структурами.


Четвёртый - микроскопия. 3D модель "монстра" первой хромосомы хороша тем, что её можно проверить, рассматривая молекулу белка в флуоресцентный микроскоп. "Монстр" первой хромосомы такой крупный, что его  видно в микроскоп в отличие от мелких белков. В частности, диаметр начальной фрактальной петли (правая часть) примерно 100 нанометров,  т.е. 0.1 микрона. 


https://img-fotki.yandex.ru/get/874316/158289418.4bc/0_18a505_811b15df_orig.gif

https://img-fotki.yandex.ru/get/9494/158289418.4bc/0_18a589_4694862e_orig.gif


Пикотехнология как дополнение к РСА


Программа Пикотех не может полностью заменить РСА. Однако она очень усиливает самые слабые стороны РСА, а именно достоверно показывает вторичную структуру и ближний порядок расположения атомов третичной структуры в момент сборки белковой молекулы рибосомой.


Чувствительность РСА такова, что он не замечает не только отдельных атомов, но и отдельных аминокислотных остатков. Более того, "хвосты" белковых молекул, которые не кристаллизуются, РСА вообще "не видит", а эти "хвосты" могут насчитывать до 50 аминокислотных остатков.


Особый класс образуют 97% белковых молекул, которые не кристаллизуются. Про них РСА просто ничего не знает, а программа Пикотех так же достоверно показывает их вторичную структуру и ближний порядок расположения атомов в третичной структуре.


 Online service "ProteinPicotech"


Литература


1.Монография А.Кушелев, В.Соколик "Геометрия живого наномира. Пикотехнология белков"  https://www.morebooks.de/ru/search?utf8 … 0%BE%D0%B2  
Предисловие рецензентов и авторов http://nanoworld.org.ru/post/55717/#p55717 
Ознакомиться с началом монографии можно по ссылке http://nanoworld.org.ru/post/54741/#p54741 
2.    Кушелев А.Ю., Соколик В.В. Пикотехнология – новый подход в моделировании пространственной структуры белка / Заочная Международная научно-практическая конференция «Современная наука: тенденции развития» (24 января 2012), Краснодар: НИЦ Априори. – 2012. – С.203-207.
3.    Соколик В.В. Предсказание пространственной структуры белка insilico на основе информации генома и геометрического алгоритма – альтернатива  квантово-механическому подходу // Материалы Международной научной конференции «Математическое и компьютерное моделирование в биологии и химии. Перспективы развития» (28-30 мая 2012), Казань. – 2012. – С.155-158.
4.    Sokolik V.V. Protein is coded in genome and synthesized in ribosomes as a structural template of a rotameric version sequence of peptide bound configuration // The International Moscow Conference on Computational Molecular Biology, МССМВ-11, Moscow. – 2011. – P. 347–348.
5.    Sokolik V.V. Algorithm of protein structural template decoding according to its determined nucleotide sequence // Fist International Conference “Fundamental medicine: From scalpel toward Genome, Proteome and Lipidome”, Pax Grid Virtual Conferences, Kazan. – 2011. – P. 117–119.
6.    Sokolik V.V. Modeling of the individual structural template of protein on determining it nucleotide sequences // VII Международная конференция по биоинформатике, регуляции структуры геномов и системной биологии. BGRS\SB-2010, Новосибирск. – 2010. – С. 275.
7.    Соколик В.В. Способ моделирования пространственной структуры белка по детерминирующей его нуклеотидной последовательности // Биофизический вестник. – 2010. – Вып. 24 (1). – С. 31-45.

http://nanoworld.org.ru/post/96761/#p96761



Вероятность замыкания дисульфидных мостиков в лизоцимах

Вероятность случайного совпадения результата работы геометрического алгоритма с экспериментальными данными ничтожна. Для каждого участка отдельно она не превышает:

1. 4^-18
2. 4^-21
3. 4^-4
4. 4^-4
5. 4^-12

Вероятность угадать все 5 участков не превышает 4^-(18+21+4+4+12)=4^-59 Примерно такая же вероятность случайно нащупать иголку в стоге сена размером с Солнечную систему, не вынимая руки из кармана.


Убедительны ли модельные эксперименты?


Фрагменты моделей белков, замкнувшихся через дисульфидные мостики в процессе автоматической сборки по таблице композиционного генетического кода.


https://img-fotki.yandex.ru/get/107080/158289418.3c1/0_1705b1_dc9f55fd_M.gif https://img-fotki.yandex.ru/get/169883/158289418.3b3/0_16f622_63ae0418_M.gif
https://img-fotki.yandex.ru/get/53993/158289418.3c3/0_170898_94d9b5cd_orig.gif https://img-fotki.yandex.ru/get/98619/158289418.3c3/0_1706b3_7dab967d_orig.gif


Пикотехнолгия помогла найти ошибки рентгено-структурного анализа

Как устроены реальные программные спирали белка


Модель коллагена (программная 335-спираль) -  яркая демонстрация несовершенства рентгеноструктурного анализа. Специалисты по РСА конструируют спираль коллагена из того, что им известно. А известна им альфа-спираль. Вот они и сконструировали модель из 3 альфа-спиралей. Программа Пикотех показывает, что это не тройная, а одинарная, но программная 335-спираль. Радикалы аминокислот действительно располагаются в виде трёх-заходной спирали, что и сбило с толку специалистов по РСА.

Другие программные спирали специалисты по РСА тоже ошибочно интерпретируют известными им "базовыми спиралями", но настало время показать, как устроены реальные, программные спирали белков.

Другими яркими примерами, демонстрирующими несостоятельность РСА, являются  сверхдлинные, в том числе программные спирали.

Наконец, Пикотехнология в отличие от РСА имеет возможность самоповерки. В частности, самоповеркой является 100%-ная корреляция между первичной и вторичной структурой некоторых белков, например, сверхдлинных программных спиралей. Спирали длиной более 1000 витков исключают случайные совпадения, согласитесь. Например, вероятность случайного совпадения композиционных кодов для 310-спирали длиной более 3982 аминокислотных остатков не превышает 4^-3982=2.5*10^-2397, т.е. более двух тысяч нулей после запятой.    

Подробнее об этом белке можно прочесть здесь.

 


https://img-fotki.yandex.ru/get/4000/158289418.421/0_17aaf5_65d3d6c0_orig.gif

Открыт новый тип белковой структуры - метиониновая спираль


Пикотехнология белков, ДНК, РНК - 2

http://www.myshared.ru/slide/643151/

Цитата: 15  МЕТИОНИН - незаменимая АМК. Необходима для синтеза белков, участвует в реакциях дезаминирования, является источником серы для синтеза цистеина. Метионил-тРНК участвует в инициации трансляции. Метильная группа метионина - мобильный одноуглеродный фрагмент, используемый для синтеза ряда соединений в реакциях переноса этой группы на соответствующий акцептор (реакция транс- метилирования) Метильная группа в молекуле метионина прочно связана с атомом S, поэтому непосредственным донором этого одноуглеродного фрагмента служит активная форма метионина - S-аденозилметионин (SAM) 
16  S-аденозилметионин (SAM) - сульфониевая форма метионина, образующаяся при его присоединении к молекуле аденозина (продукта гидролиза АТФ) Реакция активации метионина Присутствует во всех типах клеток Структура (S + -CH 3 ) в SAM - нестабильная группировка, определяющая высокую активность метильной группы (отсюда термин «активный метионин»). Это уникальная реакция, единственная, в результате которой освобождаются все три фосфатных остатка АТФ. Отщепление метильной группы от SAM и перенос ее на соединение -акцептор катализируют метилтрансферазы в реакциях транс- метилирования. SAM в ходе реакции превращается в S-аденозилгомоцистеин (SAГ). 
Конец цитаты.

Кушелев: Понятно. Связь Met-Cys косвенно подтверждается, т.к. Cys образуется из Met, а значит, что в мышином лизоциме тоже возможно превращение Met в Cys в процессе дозревания белка.

https://img-fotki.yandex.ru/get/196070/158289418.3c3/0_17074a_a85f2577_XL.gif



Открыт новый тип белковой структуры!

http://nanoworld.org.ru/post/82432/#p82432

>NM_207361.5 Homo sapiens FRAS1 related extracellular matrix protein 2 (FREM2), mRNA

Вторичная структура (Пикотех-2017) весит около 6 мегабайт в стандарте PNG: https://cloud.mail.ru/public/KKjH/goMgmMGAn

На яндекс-фотки не грузится. Но самый интересный фрагмент удалось вырезать в программе Paint:

https://img-fotki.yandex.ru/get/198361/158289418.3c3/0_170b41_4189c7d2_orig.png

Сиреневым цветом отмечен виток необычной метиониновой спирали. В отличие от альфа-спирали у неё более длинный шаг. Метиониновая спираль отличается от обычной альфа-спирали примерно как резьба с более крупным шагом от резьбы с менее крупным шагом:

https://img-fotki.yandex.ru/get/51827/158289418.3c3/0_170b47_51f461c_XL.jpg

Шаг метиониновой спирали примерно на 25% крупнее шага обычной альфа-спирали. При этом на один виток приходится тоже 3.6...3.7 аминокислотных остатка Met.

 

https://img-fotki.yandex.ru/get/196020/158289418.3c3/0_170b49_279861eb_orig.png


Ещё один интересный участок этого белка 3916...4164. Он содержит все типы композиционных кодов: 1,2,3,4, но ... не содержит ни одного витка спирали! Интересно оценить вероятность случайной комбинации композиционных кодов такого типа. Напомню, что спираль возникает при трёхкратном (или более) повторении кодов 1, 4 или их комбинации. При этом третий код должен быть "4", либо спиральных кодов (1,4), идущих подряд, должно быть больше 3.

 

 

https://img-fotki.yandex.ru/get/196020/158289418.3c3/0_170b4a_2d1597d3_orig.png


Белковая молекула кончается витком полилизиновой пи-спирали, похожей на винт Архимеда.

 

 

 

Подробнее 

 Обсуждение

3D стркутуры Пикотехнологии, построенные по геометрическому алгоритму

vtvtvtv

ngngng
vxvxv

https://www.ncbi.nlm.nih.gov/protein/97 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/973106333

KUK63703

>ENA|KUK63703|
ttgggttcaggtacaaacgccagcaccctttctgaaactgttactgttactgttactgtt
actgttactgttactgttactgttactgtta ctgttactgttactgttactgttactgt
tattatataa

https://img-fotki.yandex.ru/get/94189/158289418.3e3/0_176b26_1f5e86bb_orig.png

https://img-fotki.yandex.ru/get/176508/158289418.3e3/0_176b49_61ac4e78_orig.gif

https://img-fotki.yandex.ru/get/195125/158289418.3e3/0_176b4a_3201ca6a_XL.png

https://img-fotki.yandex.ru/get/169608/158289418.3e3/0_176b4c_f058f2ed_XL.png


***
https://www.ncbi.nlm.nih.gov/protein/10 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/1095318419

SEK15922

>ENA|SEK15922|
gtgcagaggcatgggcagacgcccaagatatcctcccagcagctctctgggccagtcatc
gccaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcacc
gtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcgactttgccatgccattgccg
gcaaccggtcattgcacttga

https://img-fotki.yandex.ru/get/42692/158289418.3e3/0_176b28_33431273_orig.png

https://img-fotki.yandex.ru/get/58675/158289418.3e3/0_176b4d_5f5ee0c4_orig.gif

https://img-fotki.yandex.ru/get/174613/158289418.3e3/0_176b4e_fe8dbf4e_XL.png

***
https://www.ncbi.nlm.nih.gov/protein/68 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/682348964

KFY41221

>ENA|KFY41221|
aaactttttacgtctataatatcccctttaccgtacgtcaccgtcaccgtcaccgtcacc
gtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcacc
gtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcacc
gtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccccccagccagcc
gtggcgcatgtccacacatga

https://img-fotki.yandex.ru/get/176508/158289418.3e3/0_176b25_3cb175bb_orig.png

https://img-fotki.yandex.ru/get/169608/158289418.3e3/0_176b50_c939ebf2_orig.gif

https://img-fotki.yandex.ru/get/169608/158289418.3e3/0_176b4f_b6137aca_XL.png

***
https://www.ncbi.nlm.nih.gov/protein/10 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/1028550392

OAJ20702

>ENA|OAJ20702|
atgagcaggtcgttgagacaacctctgttcccaacacccacgctcgcatttcaagatgca
caagtaagtgtctggctcattgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtc
accgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtc
accgtcaccgtcaccgtcaccgtcaccgtcaccgtcaccgtcntaagtgtttctcttgcc
ctcatcgcccagccttgtcgacacgacttcacactcgttctcactgttcgctga

https://img-fotki.yandex.ru/get/52085/158289418.3e3/0_176b27_4eeef3bb_orig.png


***
https://www.ncbi.nlm.nih.gov/protein/92 … DGPB4AU01R

https://www.ncbi.nlm.nih.gov/nuccore/929747320

XP_014148644

>ENA|XP_014148644|
atgggacctcagaggctcagactcacagccacagccacagtcacagtcacagtcacagcc
acagtcacagtcacagtcacagtcacagtcacagtcacagtcacagtcacagtcacagtc
acagtcacagtcacagtcacagttacagtcccagtcacagacactagtagaggactagag
tctcagactccctcagagtctcagatgcagaactgcggcgaagggagacggtcgagaaag
cctcacgcaggagagtgtctaagactcttagtgggtgggggtcacagactgagacagcct
gacaagtga

https://img-fotki.yandex.ru/get/94189/158289418.3e3/0_176b29_282b6f3d_orig.png

https://img-fotki.yandex.ru/get/4526/158289418.3e3/0_176b51_bab21693_orig.gif

https://img-fotki.yandex.ru/get/177849/158289418.3e3/0_176b52_b3e29e7_XL.png

https://img-fotki.yandex.ru/get/28874/158289418.3e3/0_176b53_156f742c_XL.png

https://img-fotki.yandex.ru/get/244791/158289418.3e3/0_176b54_7b8ee6c7_XL.png

https://img-fotki.yandex.ru/get/93500/158289418.3e3/0_176b55_4f0dcfaf_XL.png

Полный комплект файлов: https://cloud.mail.ru/public/2rbQ/1taz9qHr9


    Формы, механизмы, энергия наномира. Сообщение 86 601

    Готовится 597-ой выпуск рассылки "Новости лаборатории Наномир"

    http://subscribe.ru/catalog/science.news.nanoworldnews

    Дайджест:

    597 Открыты 23232(AGAGA)- и 12121-спирали Кушелева
    Классические антигомологи барназа / barnase и биназа / binase
    34343(Q-спираль) и 14141(QVQVQ-спираль) в
    Thioalkalivibrio nitratireducens DSM 14787 protein

    https://img-fotki.yandex.ru/get/243369/158289418.3e2/0_1768db_58a9b35c_orig.png

    https://img-fotki.yandex.ru/get/197807/158289418.3e2/0_1768ca_48de53bd_XL.png

    https://img-fotki.yandex.ru/get/166206/158289418.3e2/0_1768da_e2b18a23_orig.gif

    https://img-fotki.yandex.ru/get/174613/158289418.3e3/0_176a89_e156d2be_XL.png

    https://img-fotki.yandex.ru/get/30752/158289418.3e3/0_176a88_51407844_orig.gif

    https://img-fotki.yandex.ru/get/55828/158289418.3e3/0_176a8e_a93244e3_XL.png

    https://img-fotki.yandex.ru/get/197756/158289418.3e3/0_176a90_e00cc5d2_XL.png

    https://img-fotki.yandex.ru/get/52127/158289418.3e3/0_176a8c_f8137db4_orig.gif

    Полный комплект файлов: https://cloud.mail.ru/public/2rbQ/1taz9qHr9


    Формы, механизмы, энергия наномира. Сообщение 86 627

    Пикотехнология белков, ДНК, РНК - 2

    https://www.ncbi.nlm.nih.gov/protein/30 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/308220123

    >ENA|HM444113|HM444113.1 Mnemiopsis leidyi SIX class homeobox transcription factor SIX13c (SIX13c) mRNA, partial cds

    https://img-fotki.yandex.ru/get/244791/158289418.3e4/0_176c67_863ce06_orig.png

    ***
    https://www.ncbi.nlm.nih.gov/protein/81 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/814601875

    >ENA|KKF96471|

    https://img-fotki.yandex.ru/get/176508/158289418.3e4/0_176c68_8d3dbc66_orig.png
    ***
    https://www.ncbi.nlm.nih.gov/protein/11 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/1111466951

    >ENA|CVL09568|

    https://img-fotki.yandex.ru/get/198026/158289418.3e4/0_176c65_4566d600_orig.png

    ***
    https://www.ncbi.nlm.nih.gov/protein/60 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/602736179

    >ENA|EYT97105|

    https://img-fotki.yandex.ru/get/112407/158289418.3e4/0_176c66_708ca558_orig.png
    ***
    https://www.ncbi.nlm.nih.gov/protein/10 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/1020702258

    >ENA|KZM22758|

    https://img-fotki.yandex.ru/get/111568/158289418.3e4/0_176c69_d16a6e31_orig.png
    ***
    https://www.ncbi.nlm.nih.gov/protein/14 … DGPB4AU01R

    https://www.ncbi.nlm.nih.gov/nuccore/147765387

    >ENA|CAN76050|

    https://img-fotki.yandex.ru/get/216168/158289418.3e4/0_176c64_22f5b363_orig.png



      Создан новый стандарт вторичной структуры белка!

      https://img-fotki.yandex.ru/get/108697/158289418.3e4/0_176cab_41977475_XL.png
       http://nanoworld.org.ru/post/85732/#p85732


        Locus KKF96471
        Глядя на схему вторичной структуры легко заметить терминирующие кодоны, которые встречаются после 500-го аминокислотного остатка: https://img-fotki.yandex.ru/get/176508/ … 6_orig.png

        Поэтому 3D модель в действительности состоит из нескольких отдельных моделей разных белковых молекул.

        https://img-fotki.yandex.ru/get/198361/158289418.3e4/0_176cf8_9d1316d5_XL.png

        https://img-fotki.yandex.ru/get/94189/158289418.3e4/0_176cf9_f8e17728_XL.png

        https://img-fotki.yandex.ru/get/244791/158289418.3e4/0_176cf6_3450511d_orig.gif


          Q-спираль (13131-спираль) Кушелева длиной более 200 аминокислотных остатков:

          >ENA|CVL09568|
          https://img-fotki.yandex.ru/get/198026/158289418.3e4/0_176c65_4566d600_orig.png

          https://img-fotki.yandex.ru/get/30536/158289418.3e4/0_176d06_aae8cb52_orig.gif

          https://img-fotki.yandex.ru/get/226123/158289418.3e4/0_176d07_db0043b_XL.png

          https://img-fotki.yandex.ru/get/196365/158289418.3e4/0_176d08_a81c1ffb_XL.png

          https://img-fotki.yandex.ru/get/195431/158289418.3e4/0_176d09_d60bc7c5_XL.png

          https://img-fotki.yandex.ru/get/169883/158289418.3e4/0_176d0a_12fe5ea6_XL.png

          https://img-fotki.yandex.ru/get/52790/158289418.3e4/0_176d0b_1e8c03ad_XL.png

          https://img-fotki.yandex.ru/get/57797/158289418.3e4/0_176d0c_8a39a920_XL.png

          https://img-fotki.yandex.ru/get/228104/158289418.3e4/0_176d0d_aadcf5bd_XL.png

          https://img-fotki.yandex.ru/get/195431/158289418.3e4/0_176d0e_af4417e_XL.png

          https://img-fotki.yandex.ru/get/196183/158289418.3e4/0_176d0f_119a0535_XL.png

          https://img-fotki.yandex.ru/get/30894/158289418.3e4/0_176d10_7aef9c77_XL.png

          https://img-fotki.yandex.ru/get/246231/158289418.3e4/0_176d11_685d4236_XL.png
          Q-спираль по существу является реактором, состоящим из атомов азота...




          https://www.ncbi.nlm.nih.gov/protein/30 … DGPB4AU01R

          https://www.ncbi.nlm.nih.gov/nuccore/308220123

          >ENA|HM444113|HM444113.1 Mnemiopsis leidyi SIX class homeobox transcription factor SIX13c (SIX13c) mRNA, partial cds

          https://img-fotki.yandex.ru/get/244791/158289418.3e4/0_176c67_863ce06_orig.png

          https://img-fotki.yandex.ru/get/225029/158289418.3e4/0_176d97_196ead69_XL.png

          https://img-fotki.yandex.ru/get/169451/158289418.3e4/0_176d98_c1506b98_XL.png

          https://img-fotki.yandex.ru/get/196161/158289418.3e4/0_176d99_edf81e6d_XL.png

          https://img-fotki.yandex.ru/get/60436/158289418.3e4/0_176d9b_9f79a15b_XL.png

          https://img-fotki.yandex.ru/get/42692/158289418.3e4/0_176d9c_e263724d_XL.png

          https://img-fotki.yandex.ru/get/169451/158289418.3e4/0_176d9d_aa817459_XL.png


          https://www.ncbi.nlm.nih.gov/protein/60 … DGPB4AU01R

          https://www.ncbi.nlm.nih.gov/nuccore/602736179

          >ENA|EYT97105|

          Схема вторичной структуры: https://img-fotki.yandex.ru/get/112407/ … 8_orig.png

          На схеме вторичной структуры мы видим терминирующие кодоны. Значит в 3D модели представлено несколько отдельных белковых молекул.

          https://img-fotki.yandex.ru/get/109878/158289418.3e4/0_176dc1_ef9cfd1d_XL.png

          https://img-fotki.yandex.ru/get/9116/158289418.3e4/0_176dc2_ba7df904_XL.png

          https://img-fotki.yandex.ru/get/197807/158289418.3e4/0_176dc3_a58ff018_XL.png

          https://img-fotki.yandex.ru/get/105284/158289418.3e4/0_176dc4_b6415408_XL.png

          https://img-fotki.yandex.ru/get/48807/158289418.3e5/0_176dc5_395b486d_XL.png

          https://img-fotki.yandex.ru/get/9116/158289418.3e5/0_176dc6_6b0b4f76_XL.png
          Похоже, что это вообще другая молекула. Тут нет ни длинной 13131-спирали, ни других признаков, соответствующих вторичной структуре белка EYT97105. Это модели других белковых молекул...


          Формы, механизмы, энергия наномира. Сообщение 86 655

          Пикотехнология белков, ДНК, РНК - 2

          https://www.ncbi.nlm.nih.gov/protein/10 … DGPB4AU01R

          https://www.ncbi.nlm.nih.gov/nuccore/1020702258

          >ENA|KZM22758|

          Схема вторичной структуры: https://img-fotki.yandex.ru/get/111568/ … 1_orig.png

          На схеме вторичной структуры мы видим новую программную спираль:

          https://img-fotki.yandex.ru/get/58784/158289418.3e5/0_176dc7_259400cd_XL.png

          352352-, которая переходит в программную спираль 233233- и далее, в нерегулярную структуру. При этом на протяжении всего участка сохраняется музыкальный размер и периодичность первичной структуры LPG-

          Интересно было бы вычленить эту 3D-подструктуру из полной модели белковой молекулы.

          Полная модель:

          https://img-fotki.yandex.ru/get/50388/158289418.3e5/0_176dc8_c924e4dc_XL.png

          https://img-fotki.yandex.ru/get/166206/158289418.3e5/0_176dc9_7969a735_XL.png

          https://img-fotki.yandex.ru/get/94189/158289418.3e5/0_176dca_3aae89df_XL.png

          https://img-fotki.yandex.ru/get/62701/158289418.3e5/0_176dcb_5f09dc65_XL.png

          https://img-fotki.yandex.ru/get/120031/158289418.3e5/0_176dcc_c316f777_XL.png

          https://img-fotki.yandex.ru/get/58784/158289418.3e5/0_176dcd_ed22e2ea_XL.png

          https://img-fotki.yandex.ru/get/152444/158289418.3e5/0_176dce_c5f57d42_XL.png

          А теперь посмотрим модель фрагмента:

          Locus KZM22758
          FT   CDS 757..837

          https://img-fotki.yandex.ru/get/194425/158289418.3e5/0_176dcf_883f71c6_orig.gif

          https://img-fotki.yandex.ru/get/122076/158289418.3e5/0_176dd0_2e5ca4bb_XL.png

          https://img-fotki.yandex.ru/get/172272/158289418.3e5/0_176dd1_e795a492_XL.png

          https://img-fotki.yandex.ru/get/48807/158289418.3e5/0_176dd2_c9afefa_XL.png


          Интересно, зачем нужно сохранение музыкального размера при переходе одной программной спирали в другую? Хотя ... музыкальный размер как раз не сохраняется. Сохраняется только высота нот.

          Монография В.Соколик , А. Кушелева, "Геометрия живого наномира. Пикотехнология белков".



          Купить книгу





          ПРОЧИТАТЬ ПРЕДИСЛОВИЕ РЕЦЕНЗЕНТОВ



          https://img-fotki.yandex.ru/get/6825/158289418.1da/0_11a59f_92400f64_orig.jpg

          https://img-fotki.yandex.ru/get/15582/158289418.1da/0_11a5a0_9920d12a_orig.jpg

          https://img-fotki.yandex.ru/get/6744/158289418.1da/0_11a5a1_4f339a25_orig.jpg

          https://img-fotki.yandex.ru/get/5812/158289418.1da/0_11a5a2_114eef51_orig.jpg

          https://img-fotki.yandex.ru/get/6740/158289418.1da/0_11a5a3_f52b38b1_orig.jpg




          https://img-fotki.yandex.ru/get/3009/158289418.1da/0_11a5a4_87c7274a_orig.jpg

          https://img-fotki.yandex.ru/get/4524/158289418.1da/0_11a5a5_d1a6c3c6_orig.jpg

          https://img-fotki.yandex.ru/get/16118/158289418.1da/0_11a5a6_8194ce7c_orig.jpg


          https://img-fotki.yandex.ru/get/15572/158289418.1da/0_11a5a7_7f4f4894_orig.jpg

          Подробнее




          The greatest enemy of knowledge is not ignorance, it is the illusion

          Stephen Hawking


          Sokolik VV, Kushelev AY

          Geometry live nanoworld. Pikotechnology proteins / VV Sokolik, AY Kushelev. - Kharkov: Publishing, 2015. – 358 p.


          The monograph is devoted to the 3D-structure of molecules and polymers in living systems. The analysis of the modern understanding of the fundamental concepts of the physical volume of the atom, chemical bonding, and the genetic code is presented. Based on statistical analysis of the experimental data on the protein structure is justified coding secondary structure and structural polypeptide template of protein in the genome. Propose additions table of the genetic code of proteins and peptides, which formed the basis of the geometric algorithm software decoding structural template protein, are Molecular Constructor and Picotex. The hypothesis of recoding information to third nucleotide codon in the corresponding peptide bond rotamer directly 3D-structure isoacceptors tRNA is formulated. Mathematical analysis of contingency angles φ and ψ (Ramachandran map) revealed their frequency changes as possible to substantiate the mechanism of post-translational protein folding.

          The book is intended for professionals involved in research in the field of molecular biology, bioinformatics, biochemistry and biophysics.

          Table: 36. Ill: 117. Refs: 227 titles.


          ПРЕДИСЛОВИЕ РЕЦЕНЗЕНТОВ


          В 21-м столетии в задаче моделирования нанообъектов таких как, атом углерода, органические молекулы, пары комплементарных нуклеотидов и многих других используется кольцегранная модель строения атома. В монографии В.В. Соколик и А.Ю. Кушелева «Геометрия живого наномира. Пикотехнология белков» при помощи кольцегранного подхода к строению атома наглядно (образ – модель) реализуются различные виды, свойства и особенности межатомных взаимодействий, валентные углы в молекулах, разновидности химических связей и их соотношение. Кольцегранная модель реалистично объясняет гибридизацию электронов при формировании химических связей в молекулах, что является краеугольным камнем всей биохимии белкового мира, поскольку атомы углерода в состоянии sp3-гибридизации своих электронов входят в состав скелета аминокислот и таким способом детерминируют углы между химическими связями в их молекулах, а в последующем и в структуре белка в целом.

          В монографии В.В. Соколик и А.Ю. Кушелева «Геометрия живого наномира. Пикотехнология белков» сформулирована идея композиционного генетического кода, кодирования ротамерии пептидной связи и структурного шаблона белка. Показано, что в геноме третьим нуклеотидом кодона детерминирован один из трёх ротамерных вариантов пептидной связи, которым аминокислотный остаток (закодированный дуплетом первых двух нуклеотидом кодона) присоединяется к растущей полипептидной цепи. Ротамерный вариант пептидной связи реализуется в процессе синтеза белка в рибосоме и поэтому с неё сходит индивидуальный структурный шаблон белка в соответствие с информацией, содержащейся в его гене. Данный механизм трансляции генетической информации является эволюционно новым. Его формирование у эукариот было обусловлено необходимостью синтеза больших и сложных белков в виде структурного шаблона, максимально приближенного к функциональной конформации этих белков, чтобы их фолдинг имел наибольшие эффективность и однозначность. У прокариот и органелл эукариот третий нуклеотид кодонов в генах небольших полипептидов ещё не является информационным, поэтому на нём и наблюдается воблирование.

          Выше изложенные положения легли в основу алгоритма авторских компьютерных программ, которые по нуклеотидной последовательности мРНК позволяют смоделировать схему вторичной структуры и 3D-структуру индивидуального структурного шаблон любого белка. Эту первичную информацию о белке можно использовать в дальнейшем моделировании фолдинга функциональной конформации белка с учетом физ-химии его микроокружения, посттрансляционных модификаций, взаимодействия с лигандами методами молекулярной динамики и доккинга наравне с информацией о наиболее стабильном конформере, которую извлекают из рентгенограмм кристаллов белков. Преимущество данного подхода состоит в возможности быстрого моделирования индивидуальной пространственной структуры отдельной молекулы любого белка с точностью до электрона (пикотехнология), опираясь лишь на информацию о нём в геноме. То есть, in silico воспроизводится трансляция генетической информации в индивидуальный структурный шаблон белка. Не исключено, что большинство белков именно из конформации своего структурного шаблона максимально быстро, а главное однозначно, фолдируют в нативную конформацию с минимумом свободной энергии, формируя, таким образом, «устойчивое большинство» конформационно лабильного белкового пула.

          Авторами монографии предложен современный, точный и удобный методологический подход в арсенале молекулярной биологии для моделирования пространственной структуры белков, исходя из той информации генома о них, которой располагает сама клетка.

          Итак, перед читателем книга, вводящая в мир идей и результатов, ориентированных на применение в протеомике кольцегранной модели и молекулярный полиморфизм, основанный на структурном разнообразии биомак-ромолекул. В этой области причудливым и невероятным образом пересекаются достижения многих областей современной науки: физики и химии, биологии и медицины, математики и информатики.

          Доктор физико-математических наук С.М. Шульга

          В настоящее время моделирование пептидов и белков относится к современным и востребованным методическим подходам, позволяющим не только дополнять, но и порой с успехом заменять условно гуманные эксперименты на лабораторных животных, касающиеся взаимодействия различных биогенных соединений с клеточными структурами. К сожалению, дан-ными подходами владеют не многие естествоиспытатели, успешно работающие в своих областях наук. И в этом случае монография В.В. Соколик и А.Ю. Кушелева «Геометрия живого наномира. Пикотехнология белков» позволяет если не овладеть, то, по крайней мере, понять суть применяемых авторами методов построения моделей белков и их кодирования в геноме. Тем более, что книга очень увлекательно и доступно написана. Достигается эта легкость понимания материала тем, что в монографии четко прослеживается научная логика рассуждений и методических подходов авторов. Читателя знакомят с развитием теории строения атома, как с традиционными уже исторически устоявшимися сведениями, так и с новыми интерпретациями кольцегранной структуры атома и аппроксимации геометрии кольцегранной электронной оболочки архимедовыми телами. Авторы пользуются новой «системой координат», их пикотехнология – это технология электронного уровня, разрешение и точность которой сопоставимы с толщиной закольцованного луча-электрона (пикометр – 10-12 м) в атомах белка. Именно этот подход лежит в основе разработанного авторами геометрического алгоритма определения атомного радиуса.

          Одним из важнейших итогов материала монографии В.В. Соколик и А.Ю. Кушелева является реальная возможность с помощью законов геометрии макромира рассчитывать положения атомов в молекуле, не прибегая к квантово-механическим функциям. Такие перспективы обеспечиваются ещё и закономерностями формообразования молекул, которые определены структурой внешних кольцегранных оболочек их атомов, которая, как показано авторами, типична для элементов каждой группы таблицы Менделеева. Сопоставление в монографии экспериментальных данных с представленными моделями протеиногенных аминокислот, рассчитанными геометрическим способом для шаблона многогранных моделей аминокислот, аргументирует убедительность и логичность методологии авторов. Кроме моделей самих аминокислот, авторы уточняют способ объединения их в полипептидах, возможность формирования трех видов ротамеров пептидной связи (R, 0 или L-ротамеров), которые интерпретируются авторами в качестве прототипов соответствующих конформеров вторичной структуры в белках.

          Через призму теории формирования внешней электронной кольцегранной оболочки атома авторы рассматривают последовательно весь геометрический процесс построения пептидов – от пространственной структуры аминокислот до вторичной конформации и этапов фолдинга белковой молекулы. Логичным фрагментом исследований, изложенных в монографии, является объяснение способа и механизма кодирования и декодирования информации о структурном шаблоне белка в геноме.

          Детально охарактеризованы декодированные в программах Molecular Constructor и Picotech В.В. Соколик и А.Ю. Кушелева структурные шаблоны белков в качестве субъектов последующего фолдинга. Представлен количественный сравнительный анализ декодированных структур с соответствующими экспериментальными моделями из базы данных PDB. Особое внимание уделено способам описания пространственной структуры белка и характеристике элементов вторичной структуры, а также современным методам моделирования in silico.

          Следует отметить, что данная монография актуальна не только как научный труд. Собственный интерес авторов к своей работе заражает, более чем полный массивный объем информации, увлекательная и яркая форма ее изложения и оформления делает монографию применимой также и в качестве учебника для студентов естественнонаучных специальностей, особенно таких, как биохимия, биофизика и биотехнология.


          Доктор биологических наук Г.А.Божок


          ПРЕДИСЛОВИЕ АВТОРОВ


          Главная цель, которую поставили перед собой авторы этой книги, это задействование возможностей и закономерностей пространственной геометрии атомов, точнее, их электронных оболочек, в построении моделей белков.

          Почему пикотехнология белков? Мир, с которым мы привыкли иметь дело в обиходе, называют макромиром, базовой единицей измерения которого является метр (м). В конце XIX века был обнаружен микромир, харак-терным размером которого являются габариты атома – ангстрем (1Å – 10-10 м). На базе законов микромира создавалась современная нанотехнология (10-9 м). Еще раньше был открыт мегамир, порядок величин в котором – размер галактик (30 парсек – 1015 м). Поскольку эти миры имеют граничные размеры, значит, за их пределами лежат другие миры, с иным характерным размером, на несколько порядков меньше ангстрема и больше парсека. Пи-котехнология – это технология электронного уровня, разрешение и точность которой сопоставимы с толщиной закольцованного луча-электрона (пико-метр – 10-12 м) в атомах белка.

          Читатель, который не намерен сразу вникать в физический смысл кольцегранной модели атома и химическое обоснование ротамерии пептидной связи, может пропустить первые две главы книги и начинать с принципов декодирования структурного шаблона белка по детерминирующей его нуклеотидной последовательности, а затем из любопытства вернуться к пропущенному.

          Мы не включили в данную книгу разделы о структуре ядра атома и взаимодействии нуклонов, а также большой материал о конформационной подвижности белковых молекул в зависимости от микроокружения. Такое ограничение обусловлено тем, что в геноме детерминированы, прежде всего, уникальные структурные шаблоны белков, трансляция которых в ходе матричного синтеза определяет геометрию электронных поверхностей новосинтезированных белков независимо от микроокружения. Кроме этого, мы, по примеру выдающегося физика-астролога Стивена Хокинга, стремились избегать любых формул.

          Авторы выражают благодарность друзьям и коллегам за обсуждение монографии и рады любым замечаниям, которые помогут её усовершенствовать.


          В.В. Соколик, А.Ю. Кушелев


          ***


          ВВЕДЕНИЕ


          Общая схема построения монографии подчинена логике: «структура общего определяется упорядоченной структурой всех его компонентов». Руководствуясь этой установкой, в 1 главе представлены обоснования и новые интерпретации кольцегранной структуры атома, аппроксимация его физического объёма и геометрии кольцегранной электронной оболочки архимедовыми телами, а также приведен, разработанный авторами, геометрический алгоритм определения атомного радиуса. Во 2 главе выполнен анализ представлений о химической связи и гибридизации электронных орбиталей с позиций перекрывания не электронных плотностей, а вакантных мест во внешней кольцегранной электронной оболочке атомов при формировании молекул из них. С этих позиций охарактеризованы атомы элементов таблицы Менделеева. В 3 главе рассмотрен разработанный и реализованный в программе Molecular Сonstructor (МС) геометрический алгоритм расчета координат центров атомов в моделях протеиногенных аминокислот. Введены понятия ротамерии пептидной связи между аминокислотными остатками и структурного полипептидного шаблона белка. Результаты модельных экспериментов показали, что повторение R, 0 или L-ротамеров пептидной связи обусловливает формирование правых, левых (поворотов) и β-спиралей. Мы их интерпретируем в качестве прототипов соответствующих конформеров вторичной структуры в белках. 4 глава посвящена способу кодирования и механизму декодирования информации о структурном шаблоне белка в геноме. А именно приведен статистический анализ экспериментальных данных в пользу специфического детерминирования в геноме конформеров вторичной структуры и шаблона пространственной структуры белка, согласно предложенной таблице генетического кода структурного шаблона белка. Обсуждается заявленная гипотеза о перекодировании информации третьего нуклеотида кодонов в ротамер пептидной связи непосредственно 3D-структурой изоакцепторных адапторных РНК к синонимичным кодонам. В последней 5 главе кратко изложены современные представления о фолдинге белка и охарактеризованы структурные шаблоны 100 белков из базы PDB, декодированные в программах Molecular Constructor и Picotech.


          https://img-fotki.yandex.ru/get/6406/158289418.20f/0_129776_c915bdf6_orig.pnghttps://img-fotki.yandex.ru/get/3013/158289418.20f/0_129777_5d138e11_orig.png



          Стр 110-111

          https://img-fotki.yandex.ru/get/9803/158289418.20f/0_129778_35eeac24_orig.png


          Стр. 146-147


          https://img-fotki.yandex.ru/get/6523/158289418.20f/0_129781_c3f9d563_orig.pnghttps://img-fotki.yandex.ru/get/6831/158289418.20f/0_129784_393caf0d_orig.pnghttps://img-fotki.yandex.ru/get/4135/158289418.210/0_129785_9c346658_orig.png




          НОВИЗНА ИДЕЙ ИЛИ ПОСЛЕСЛОВИЕ


          1. Впервые продемонстрирован алгоритм моделирования 3D-геометрии атомов и молекул на основе кольцегранной модели атома и её апроксимации телами Архимеда. Представлен метод расчета атомных радиусов атомов элементов таблицы Менделеева исходя из экспериментальных значений их ковалентных радиусов с учётом геометрии электронной поверхности.
          2. Заново переосмыслено понятие химической связи: перекрывание вакантных мест (а не электронной плотности) внешних электронных кольцегранных оболочек взаимодействующих атомов, что приводит к их реальному сближению и снижению электронной плотности между атомами в молекуле, сопровождающееся уменьшением общей энергии системы и напряжения в ней.
          3. Введено понятие о R (right)-, 0 (zero)- и L (left)-ротамеров пептидной связи, которые различаются между собой поворотом на угол кратный 120о.
          4. Статистически обосновано кодирование ротамеров пептидной связи, фрагментов вторичной структуры и структурных шаблонов белков в целом в геноме эукариот. Представлена таблица генетического кода структурного шаблона белка.
          5. Сформулирована гипотеза о перекодировании информации третьего нуклеотида кодонов в соответствующий ротамер пептидной связи непосредственно самой 3D-структурой изоакцепторной тРНК, а точнее углом поворота её акцепторного стебля вокруг своей оси. 
          6. Математический анализ сопряженности значений углов φ и ψ (карта Рамачандрана) для вторичных структур позволил обнаружить период их изменения в 120о при переходе от одной вторичной структуры к другой и предложить возможный механизм посттрансляционного фолдинга белка.
          7. Разработаны две авторские программы декодирования структурного шаблона белка Molecular Constructor и Picotech.


          АВТОРСКИЕ ПУБЛИКАЦИИ


          1. Соколик В.В. Кодирование вторичной структуры и структурного шаблона белка в геноме эукариот / НАУЧНЫЙ ФОНД "БИОЛОГ", Ежемесячный научный журнал. – 2014. – № 3. – С. 73-76.
          2. Соколик В.В. Никакой дополнительной информации, большей, чем та, что содержится в ДНК, для сворачивания белка не требуется / Ukr. Biochem. J., 2014. – 86, 5 (Suppl. 1) Матеріали ХІ Укріїнського біохімічного конгресу (06-10 жовтня 2014), Київ, c. 37-38.
          3. Соколик В.В. Предсказание пространственной структуры белка in silico на основе информации генома и геометрического алгоритма – альтернатива квантово-механическому подходу / Материалы Международной научной конференции «Математическое и компьютерное моделирование в биологии и химии. Перспективы развития» (28-30 мая 2012), Казань. – 2012. – С.155-158.
          4. Соколик В.В. Геометрия аминокислот / Материалы XV Международной научно-практической конференции «Наука и современность – 2012» (НС-15), (14 марта 2012), Новосибирск. – 2012. – С. 13-18.
          5. Кушелев А.Ю., Соколик В.В. Пикотехнология – новый подход в моделировании пространственной структуры белка / Заочная Международная научно-практическая конференция «Современная наука: тенденции развития» (24 января 2012), Краснодар: НИЦ Априори. – 2012. – С.203-207.
          6. Соколик В.В. Загадка изоакцепторных тРНК / Материалы II Всероссийской Интернет-Конференции «Актуальные проблемы биохимии и бионанотехнологии» (15-18 ноября 2011), Казань, Россия. – С. 11-15.
          7. Соколик В.В. Кодирование торсинного угла ω пептидной связи в белке / IV Международная конфер. "Актуальные проблемы биологии, нанотехнологий и медицины". (22-25 сентября 2011), Ростов-на-Дону. – С. 60-61.
          8. Sokolik V.V. Protein is coded in genome and synthesized in ribosomes as a structural template of a rotameric version sequence of peptide bound configuration / The International Moscow Conference on Computational Molecular Biology, МССМВ-11 (July 21-24, 2011), Moscow, Russia. – P. 347-348.
          9. Соколик В.В. Карта Рамачандрана: ротамерия пептидной связи и фолдинг белка / Материалы VII Международной научно-технической конференции «Актуальні питання біологічної фізики і хімії». Тезисы докладов БФФХ-2011 (26-30 апреля 2011 г.), Севастополь.– С.137-139.
          10. Sokolik V.V. Algorithm of protein structural template decoding according to its determined nucleotide sequence / Fist International Conference “Fundamental Medicine: From Scalpel Toward Genome, Proteome and Lipidome” (April 25-28, 2011), Pax Grid Virtual Conferences, Kazan, Russia. – P. 117-119.
          11. Соколик В.В. Ротамерные варианты конфигурации пептидной связи и их кодирование в геноме / Матеріали X Українського біохімічного з’їзду. Тези доповідей (13—17 вересня 2010 р.), Одеса. – С. 105-106.
          12. Соколик В.В. Способ моделирования пространственной структуры белка по детерминирующей его нуклеотидной последовательности // Біофізичний вісник. – 2010. - Вип. 24 (1). – С. 31-45.
          13. Sokolik V.V. Modeling of the individual structural template of protein on determining it nucleotide sequences / Материалы VII Международной конференции по биоинформатике, регуляции и структуры геномов и системной биологии (BGRS\SB-2010). Тезисы докладов (20-27 июня 2010 г.), Новосибирск. – С. 275.
          14. Соколик В.В. Пространственная структура гомологов основного актина и α-актина 1 различна / Сборник материалов I Международной научно-практической конференции «Наука и современность – 2010» в 3-х частях / Под общ. ред. С.С. Чернова - Новосибирск: «СИБПРИНТ», 2010. – 278 с. Ч. 1, С. 41-46.
          15. Соколик В.В. Моделирование пространственной структуры белка по детерминирующей его нуклеотидной последовательности / Материалы VI Международной научно-технической конференции «Актуальні питання теоретичної і прикладної біофізики, фізики і хімії». Тезисы докладов БФФХ-2010 (26-30 апреля 2010 г.), T.1, Севастополь.– С.201-204.
          16. Кушелев А.Ю., Полищук С.Е., Неделько Е.В. и др. Построение масштабной модели структуры белка // Актуальные проблемы современной науки. – 2002. – №2. – С. 236-243
          17. Кушелев А., Полищук С., Писаржевский С. Формы, механизмы, энергия наномира: Доступна ли энергия эфира для космических полётов? // Электроника: Наука, Технология, Бизнес. – 2002. – № 6. – С.72–76.
          18. Кушелев А.Ю., Соколик В.В. http://www.nanoworld.org.ru/.


          Принимаются предложения по распространению электронного тиража учебника "Пикотехнология белков" и перевод на английский язык для распространения учебника среди англоязычных читателей.

          Обсуждение




          Доклад Виктории Соколик на XI Украинском биохимическом конгрессе, 2014




          http://nanoworld.org.ru/post/46445/#p46445


          Виктория Соколик: 6-10 октября сего года в Киеве проходил очередной конгресс украинского биохимического общества, на котором был представлен мой доклад по пикотехнологии белков "Информация о структуре белка содержится в геноме".


          Эта информация тезисно опубликована в материалах конгресса:
          В.В. Соколик "Никакой дополнительной информации, большей, чем та, что содержится в ДНК, для сворачивания белка не требуется" Матеріали ХІ Укріїнського біохімічного конгресу (06-10 жовтня 2014), The Ukrainian Biochemical Journal, 2014, V. 86, №5 (Supplement 1), P. 37-38.


          НИКАКОЙ ДОПОЛНИТЕЛЬНОЙ ИНФОРМАЦИИ, БОЛЬШЕЙ, ЧЕМ ТА, ЧТО СОДЕРЖИТСЯ В ДНК, ДЛЯ СВОРАЧИВАНИЯ БЕЛКА НЕ ТРЕБУЕТСЯ
          СОЛОЛИК В.В.


          ГУ «Институт неврологии, психиатрии и наркологии НАМН Украины», Харьков;
          e-mail: Sokolik67@rambler.ru


          Фолдинг белка причисляют к пулу крупнейших научных проблем современности. Скорость сворачивания белка in vivo объясняют кооперативными эффектами – одновременным формированием «зародышей» вторичной структуры, благодаря чему молекула белка находит «кратчайший путь» на воображаемой гиперплоскости потенциальной энергии к точке, соответствующей нативной конформации. Как правило, реализуется один из трех сценариев: котрансляционное сворачивание новосинтезированного полипептида без шаперонов, с помощью молекулярных шаперонов или сопряженно с трансмембранной транслокацией. Один из подходов для описания рефолдинга денатурированных белков in vitro также постулирует, что сворачивание белка начинается с образования элементов вторичной структуры независимо от третичной или, по крайней мере, до завершения формирования последней. В обоих случаях (in vivo и in vitro) отправным пунктом успешного фолдинга является формирование первичного каркаса с мотивами вторичной структуры белка. Эти данные послужили основанием для предположения о том, что кроме аминокислотной последовательности в генах белков закодирована информация об их индивидуальных структурных шаблонах (каркасах) из фрагментов вторичной структуры. Цель исследования состояла в выявлении специфичности кодирования вторичной структуры в генах белков эукариот. 


          Дизайн исследования. Проанализировали случайную выборку из 100 белков эукариот, для которых в базе данных PDB представлены схемы вторичной структуры. Оценивали абсолютную и относительную частоту встречаемости кодонов вида XYC/G, XYА и XYТ и их кластеров (XYC/G)n, (XYА)n и (XYТ)n, n?3, в нуклеотидных последовательностях, детерминирующих спиральные фрагменты, ?-тяжи, повороты и неструктурированные мотивы белков. Результаты обрабатывали статистически. t-Критерий Стьюдента использовали для анализа производных показателей (абсолютная и относительная частота), убедившись в нормальности распределения. P-тест Фишера и четырехпольные таблицы – для выявления статистической зависимости между конформерами и разновидностями кодонов и/или их кластеров. Различие считали статистически значимым при p ? 0,05, тенденция к значимым отличиям при p ? 0,10. 


          Результаты. Установили, что правая спираль кодируется кластерами кодонов (XYC/G)n, n?3 (Р = 7.33?10-22, ?2 = 42.62). Повороты детерминированы кластерами кодонов (XYA)n, n?3. Эти данные согласуются с выявленным достоверным превышением относительной частоты встречаемости кластеров (XYC/G)n, n?3 и (XYA)n, n?3 в областях генов, кодирующих спиральные фрагменты и повороты, соответственно. ?-Тяжи менее жестко детерминированы кодонами XYT. Тест Фишера показал кодирование ?-тяжей кодонами XYT или их кластерами (XYТ)n, n?3: Р = 3.63?10-6 (?2 = 22.05) и Р = 3.43?10-2 (?2 = 4.56) для изучаемого пула белков. Обсуждается роль изоакцепторных тРНК с синонимичными кодонами в перекодировании информации третьего нуклеотида кодонов и их кластеров в ходе матричного синтеза белка. Создана программа Молекулярный конструктор, которая декодирует нуклеотидную последовательность с созданием pdb файла и визуализацией индивидуального структурного шаблона белка в качестве основы для дальнейших исследований методами молекулярной динамики.


          Вывод. В геноме эукариот содержится информация о структуре белков.
          1–Структура, властивості та функції біологічних макромолекул


          Презентация самого доклада:

          http://img-fotki.yandex.ru/get/6843/158289418.195/0_fc3a7_f0b7c4a8_orig.jpg


          http://img-fotki.yandex.ru/get/6816/158289418.195/0_fc3a8_676dfdfc_orig.jpg


          http://img-fotki.yandex.ru/get/5108/158289418.195/0_fc3a9_1b993a38_orig.jpg


          http://img-fotki.yandex.ru/get/6843/158289418.195/0_fc3aa_7ed2ccf5_orig.jpg


          http://img-fotki.yandex.ru/get/2712/158289418.195/0_fc3ab_ed57753f_orig.jpg


          http://img-fotki.yandex.ru/get/6733/158289418.195/0_fc3ac_f972ff5b_orig.jpg


          http://img-fotki.yandex.ru/get/2712/158289418.195/0_fc3ad_95c3c50d_orig.jpg


          http://img-fotki.yandex.ru/get/6847/158289418.195/0_fc3ae_fd583210_orig.jpg


          http://img-fotki.yandex.ru/get/3110/158289418.195/0_fc3af_dd16de30_orig.jpg


          http://img-fotki.yandex.ru/get/2713/158289418.195/0_fc3b0_ff0cd2aa_orig.jpg


          http://img-fotki.yandex.ru/get/6843/158289418.195/0_fc3b1_ae220bb7_orig.jpg


          http://img-fotki.yandex.ru/get/3414/158289418.195/0_fc3b2_cf0f9245_orig.jpg


          http://img-fotki.yandex.ru/get/6740/158289418.195/0_fc3b3_b4097e2_orig.jpg


          http://img-fotki.yandex.ru/get/2713/158289418.195/0_fc3b4_249a725b_orig.jpg


          http://img-fotki.yandex.ru/get/3202/158289418.195/0_fc3b5_7db79618_orig.jpg


          http://img-fotki.yandex.ru/get/5108/158289418.195/0_fc3b6_28116217_orig.jpg


          http://img-fotki.yandex.ru/get/2710/158289418.195/0_fc3b7_8322ea83_orig.jpg


          http://img-fotki.yandex.ru/get/3307/158289418.195/0_fc3b8_efbb7d68_orig.jpg


          http://img-fotki.yandex.ru/get/2708/158289418.195/0_fc3b9_fb8aea95_orig.jpg


          http://img-fotki.yandex.ru/get/2712/158289418.195/0_fc3ba_7530e83a_orig.jpg


          http://img-fotki.yandex.ru/get/2713/158289418.195/0_fc3bb_82896881_orig.jpg



          2D Диаграммы Пкотехнологии




          КАК ЧИТАТЬ 2D ДИАГРАММЫ ПИКОТЕХНОЛОГИИ


          СОКРАЩЁННАЯ ДИАГРАММА


          Красный - альфа-спираль.
          Оранжевый - 310-спираль.
          Розовый - одиночный код альфа/310 спиралей.
          Голубой - пи-спираль.
          Зеленый - бета-спираль.
          Сиреневый - метиониновая спираль. У неё более крупный шаг "резьбы", чем у обычной альфа-спирали.
          Черный в сокращённом представлении и белый в развернутом означают либо неизвестный код, либо конец трансляции.
          Циклическое повторение цветов - программная спираль.


          http://img-fotki.yandex.ru/get/6210/126580004.53/0_bcc31_366c6e2c_S.gif http://img-fotki.yandex.ru/get/6304/126580004.53/0_bcc32_4f52ef7b_S.gif http://img-fotki.yandex.ru/get/6302/126580004.52/0_bcc2f_a96d98c5_S.gif http://img-fotki.yandex.ru/get/6307/126580004.52/0_bcc30_b4791ec4_S.gif
          Альфа-спираль Бета-спираль Пи-спираль 310-спираль Метиониновая спираль



          https://img-fotki.yandex.ru/get/898391/158289418.498/0_1859fc_e2e79c6_orig.png


          ПОЛНАЯ ДИАГРАММА


          1 - порядковый номер аминокислотного остатка в белковой молекуле
          2 - триплетный код
          3 - однобуквенный код аминокислотного остатка
          4 - трёхбуквенное обозначение аминокислотного остатка
          5 - упрощённый композиционный код
          6 - графическая интерпретация упрощенного композиционного кода
          7 - композиционный код
          8 - графическая интерпретация композиционного кода
          9 - нота, которая звучит при установке данной аминокислоты в растущую белковую цепь
          10 - графическое изображение ноты (или ударного инструмента)

          Для новой версии Пикотех 2018 разработан Композиционный код 7var
          https://img-fotki.yandex.ru/get/914553/249950893.1/0_16ae92_83cc91e_orig.jpg

          Программные спирали - это повторение последовательности композиций. Например, один код альфа-спирали, затем один код пи-спирали. n(35) задаёт программную спираль, а n3 или n5 - простые спирали (пи-спираль и альфа-310-спираль).
          1111111111111111111 - прямая альфа-спираль
          4444444444444444444 - прямая 310-спираль
          3333333333333333333 - прямая пи-спираль
          2222222222222222222 - прямая бета-спираль
          232323 - программная 23-спираль
          141414 - программная 14-спираль


          http://nanoworld.org.ru/post/94081/#p94081

          https://img-fotki.yandex.ru/get/509063/158289418.498/0_1859fd_27b43600_orig.png



          Пи-спирали есть и в официальной науке, а в Пикотехнологии. http://nanoworld.org.ru/post/94083/#p94083 В официальной науке считается, что бета-тяжи плоские, т.е. "спираль с поворотом каждой следующей аминокислоты на 180 градусов. Пикотехнологические модели показывают, что это не тяжи, а именно правые спирали (2.5 остатка на виток). 310-спираль правая. Имеет примерно 3 остатка на виток. Альфа-спираль тоже правая. Имеет ~3.6 остатков на виток. Пи-спираль левая имеет примерно 4.1 остатка на виток: http://info-farm.ru/alphabet_index/p/pi-spiral.html .


          Модели всех типов простых спиралей показаны здесь: http://nanoworld88.narod.ru/data/302.htm

          Моделирование аминокислотных остатков http://nanoworld88.narod.ru/data/279.htm






          ИНФОРМАТИВНОСТЬ ПИКОТЕХНОЛОГИИ



          https://img-fotki.yandex.ru/get/893194/158289418.498/0_1859fe_42c2eed0_orig.png

          https://img-fotki.yandex.ru/get/477847/158289418.498/0_1859ff_f066b0ba_orig.png



          СУТЬ  МЕТОДА


          http://nanoworld88.narod.ru/data/302.htm

          Триплеты ДНК кодируют аминокислоты. По таблице обычного генетического кода:


          https://img-fotki.yandex.ru/get/509739/158289418.498/0_185a00_494c8c31_orig.jpg


          Кушелев: В упрощённом представлении третья (как бы лишняя) буква управляет углом поворота. Это я понял, когда сделал 3D модель аминокислотного остатка. Один аминокислотный остаток можно повернуть относительно другого на углы 0, 120 и 240 градусов. Когда я в этом убедился, построив пластмассовые модели нескольких белковых молекул, начались уточнения. Ведь водородные связи между соседними витками спирали могут слегка менять углы поворота. Анализ белковых структур помог составить таблицу композиционного генетического кода http://nanoworld.org.ru/post/94014/#p94014 .



          Кушелев: Официальная наука "знает" альфа-спираль, 310-спираль, пи-спираль и бета-тяж (не знает, что спираль). В устаревшей официальной науке спирали не кодируются. Для того, чтобы узнать их код, нужно открыть композиционный генетический код, что, собственно, я и сделал в 1992-ом году. Я составил её по этим данным: http://www.nanoworld.org.ru/data/01/dat … 920204.htm


          В упрощённой модели пикотехнологии учитывается поворот вокруг одной оси на 3 разных угла. Вариант "альфа" в дальнешем расщепляется на "Альфа-спираль", "310-спираль", "одиночный альфа-код". http://nanoworld.org.ru/post/94009/#p94009


          https://img-fotki.yandex.ru/get/509063/158289418.498/0_185a01_e2c81f39_orig.png



          ПОЧЕМУ ПИКОТЕХНОЛОГИЯ ТОЧНА НА 100%



          Специалисты по РСА просто не в курсе, что электрон имеет "скелет" в виде кольца диаметром типа 1.7 ангстрема (для внешних оболочек водорода, углерода, азота, кислорода... Кольцевые "скелеты" электронов формируют кольцегранные электронные оболочки и кольцевые механизмы молекул. Модели этих механизмов показывают, как складываются альфа-спираль, 310-спираль, смешанные альфа-310-спирали, пи-спирали и бета-спирали, которые оказались не по 2 остатка на виток. Кольцегранные модели помогут специалистам по РСА более точно определять структуры белков и не только. Кстати, пикотех не может определить структуры, полученные не по программе рибосомой. Если после сборки белка он обработан ферментами, например, разрезан и переделан, то программа "Пикотех" об этом не знает. Так что полностью пренебрегать РСА не стоит. Но в плане дополнения РСА "весит" в несколько раз меньше, чем "Пикотех". http://nanoworld.org.ru/post/94089/#p94089



          В современных базах данных структура белка изображается в виде опознанных участков альфа и 310-спиралей.



          https://img-fotki.yandex.ru/get/876984/158289418.498/0_185a02_c1602d27_orig.jpg

          https://img-fotki.yandex.ru/get/894110/158289418.498/0_185a03_84676294_orig.jpg



          Здесь спиральные участки (альфа- и 310-) показаны красным цветом. Остальное - неопознанная часть. В настоящее время считается, что белок в неопознанной части не имеет определенной структуры, но пикотехнология показала, что это не так. В программе "Пикотех" вся структура определена. http://nanoworld.org.ru/post/93980/#p93980


          https://img-fotki.yandex.ru/get/876984/158289418.498/0_185a04_236de89a_orig.jpg



          Данный белок состоит из программных спиралей, но в стандартном представлении его покажут либо вообще без структуры, либо изобразят кусками альфа- и 310-спиралей. Оба варианта в корне ошибочны.
          Ещё один типовой пример ошибки - изображение структуры коллагена тройной альфа-спиралью. В действительности структура данного коллагена представляет собой одинарную, но программную 335-спираль:


          https://img-fotki.yandex.ru/get/878955/158289418.498/0_185a05_9329ef4c_orig.png


          Хотя специалисты по РСА (рентгеноструктурному анализу) заявляют, что точность метода достигает долей ангстрема (меньше размера одного атома), но в действительности не могут на протяжении десятилетий отличить тройную альфа-спираль от программной 335-спирали коллагена. Это значит, что они не могут достичь атомной точности даже сегодня. Реальная погрешность РСА находится в диапазоне от нескольких атомных радиусов до сотен атомных радиусов. Например, "хвосты" белковых молекул (до 50 аминокислотных остатков) РСА может вообще не заметить. А это - сотни атомных радиусов в длину.



          РСА часто ошибается при распознании спиральных участков. Иногда вообще не замечает или показывает там, где спирали нет. А перепутать альфа-спираль с 310- Пи- или программной спиралью – элементарно. http://nanoworld.org.ru/post/94010/#p94010



          Вместо тройной спирали коллагена" программа Пикотех показывает одиночную, но "трёхзаходную" программную 335-спираль. Другими словами форма похожа, но микроструктура другая. И получена в автоматическом режиме, т.е. по табличной функции. http://nanoworld.org.ru/post/94011/#p94011



          РАБОТОСПОСОБНОСТЬ ПИКОТЕХНОЛОГИИ


          Кушелев: Работоспособность пикотехнологии имеет смысл демонстрировать во-первых на уровне вторичной структуры длинных спиралей. В т.ч. программных: http://nanoworld.org.ru/topic/1656/
          Для них легко получать точные 3D-модели.
          Акцент имеет смысл сделать на замыкании циклов лизоцима. Случайно получить замыкание циклов невозможно. Вероятность типа 1/30 000 000 000. А для программных спиралей случайность имеет вероятность типа 4^-3982=4e-2398 Подробнее: http://nanoworld.org.ru/topic/1656/page/5/
          Далее имеет смысл демонстрировать возможности Пикотех на примере белков заказчиков. Заказчики сами увидят свои белки более точно, чем о них рассказывают специалисты по РСА. Именно это и привлечёт заказчиков к более тщательному ознакомлению и использованию новой технологии. Они должны убедиться в её работоспособности и эффективности не по наслышке.
          У меня уже был негативный опыт работы с заказчиками через посредников. Искаженная и неполная информация о новой технологии только отпугивает заказчиков. Они думают, что результаты работы Пикотех должны полностью совпасть с результатами РСА. Это не так. На уровне вторичной структуры Пикотех имеет 100%-ную достоверность, а РСА на уровне 70%. 97% белков для РСА вообще недоступны, т.к. они не кристаллизуются.
          Преодолеть барьер слепой веры в РСА - дело тонкое. С помощью "испорченного телефона" задача не решается. Так что ждём потенциальных заказчиков, например, на форуме лаборатории Наномир или в скайпе. В этом случае есть шанс донести до них информацию о новой технологии без искажений.
          http://nanoworld.org.ru/post/94006/#p94006



          ПУБЛИКАЦИИ


          А.Кушелев, В.Соколик. Монография «Геометрия живого наномира. Пикотехнология белков»  2016 https://www.morebooks.de/ru/search?utf8 … 0%BE%D0%B2

          Конкурсный проект на Конкурс Министерства Образования и Науки 1993  http://nanoworld.org.ru/post/93984/#p93984 Текст  http://www.nanoworld.org.ru/data/01/dat … 930114.htm

          Таблицы по химии, Российская академия образования, 2006   http://nanoworld88.narod.ru/data/250.htm

          Медаль ВДНХ за пикотехнологические модели молекул 1989  http://www.sciteclibrary.ru/cgi-bin/yab … 691890/113




          2D диаграммы Пикотех некоторых белковых структур из базы NCBI

          1. 

          https://www.ncbi.nlm.nih.gov/Structure/ … p;uid=5TUD

          Structural insights into the extracellular recognition of the human serotonin 2B receptor by an antibody

          Ishchenko A, Wacker D, Kapoor M, Zhang A, Han GW, Basu S, Patel N, Messerschmidt M, Weierstall U, Liu W, Katritch V, Roth BL, Stevens RC, Cherezov V

          https://img-fotki.yandex.ru/get/880375/249950893.0/0_16a3b7_7315a46a_orig.png

          https://www.ebi.ac.uk/ena/data/view/CAA … play=fasta

          >ENA|CAA54513|CAA54513.1 Homo sapiens (human) 5-HT2B serotonin receptor 
          ATGGCTCTCTCTTACAGAGTGTCTGAACTTCAAAGCACAATTCCTGAGCACATTTTGCAG
          AGCACCTTTGTTCACGTTATCTCTTCTAACTGGTCTGGATTACAGACAGAATCAATACCA
          GAGGAAATGAAACAGATTGTTGAGGAACAGGGAAATAAACTGCACTGGGCAGCTCTTCTG
          ATACTCATGGTGATAATACCCACAATTGGTGGAAATACCCTTGTTATTCTGGCTGTTTCA
          CTGGAGAAGAAGCTGCAGTATGCTACTAATTACTTTCTAATGTCCTTGGCGGTGGCTGAT
          TTGCTGGTTGGATTGTTTGTGATGCCAATTGCCCTCTTGACAATAATGTTTGAGGCTATG
          TGGCCCCTCCCACTTGTTCTATGTCCTGCCTGGTTATTTCTTGACGTTCTCTTTTCAACC
          GCATCCATCATGCATCTCTGTGCCATTTCAGTGGATCGTTACATAGCCATCAAAAAGCCA
          ATCCAGGCCAATCAATATAACTCACGGGCTACAGCATTCATCAAGATTACAGTGGTGTGG
          TTAATTTCAATAGGCATTGCCATTCCAGTCCCTATTAAAGGGATAGAGACTGATGTGGAC
          AACCCAAACAATATCACTTGTGTGCTGACAAAGGAACGTTTTGGCGATTTCATGCTCTTT
          GGCTCACTGGCTGCCTTCTTCACACCTCTTGCAATTATGATTGTCACCTACTTTCTCACT
          ATCCATGCTTTACAGAAGAAGGCTTACTTAGTCAAAAACAAGCCACCTCAACGCCTAACA
          TGGTTGACTGTGTCTACAGTTTTCCAAAGGGATGAAACACCTTGCTCGTCACCGGAAAAG
          GTGGCAATGCTGGATGGTTCTCGAAAGGACAAGGCTCTGCCCAACTCAGGTGATGAAACA
          CTTATGCGAAGAACATCCACAATTGGGAAAAAGTCAGTGCAGACCATTTCCAACGAACAG
          AGAGCCTCAAAGGTCCTAGGGATTGTGTTTTTCCTCTTTTTGCTTATGTGGTGTCCCTTC
          TTTATTACAAATATAACTTTAGTTTTATGTGATTCCTGTAACCAAACTACTCTCCAAATG
          CTCCTGGAGATATTTGTGTGGATAGGCTATGTTTCCTCAGGAGTGAATCCTTTGGTCTAC
          ACCCTCTTCAATAAGACATTTCGGGATGCATTTGGCCGATATATCACCTGCAATTACCGG
          GCCACAAAGTCAGTAAAAACTCTCAGAAAACGCTCCAGTAAGATCTACTTCCGGAATCCA
          ATGGCAGAGAACTCTAAGTTTTTCAAGAAACATGGAATTCGAAATGGGATTAACCCTGCC
          ATGTACCAGAGTCCAATGAGGCTCCGAAGTTCAACCATTCAGTCTTCATCAATCATTCTA
          CTAGATACGCTTCTCCTCACTGAAAATGAAGGTGACAAAACTGAAGAGCAAGTTAGTTAT
          GTATAG

          http://nanoworld.org.ru/post/96477/#p96477
          Программа Пикотех показывает следующую детализированную структуру.
          Вторичная структура белка начинается с программной 35-спирали длиной 8 аминокислотных остатков. 8-ой остаток Ser является последним остатком программной 35-спирали и первым остатком пи-спирали, которая состоит из 4-х аминокислотных остатков. Далее идёт последовательность композиционных кодов 5233553, а за ней один виток альфа-спирали: 1111, образованный аминокислотными остатками LQST. Остатки SIP под номерами 38,39,40 образуют виток бета-спирали. Затем последовательность EEMKQI образует примерно половину витка программной 35-спирали. Остатки с 81 по 86 образуют гибридную альфа-310-спираль. Далее 87-90 идет пи-спираль. 94-98 - 310-спираль (полтора витка). 120-123 - один виток альфа-спирали. Участок 124-334 структурирован одиночными композиционными кодами всех типов. 335-341 - программная 355-спираль. 342-346 - программная 23-спираль. 346-351 - пи-спираль (примерно полтора витка). 360-363 - один виток 310-альфа-спирали. 378-383 - прямая альфа-спираль (полтора витка). 414-418 - альфа-310-спираль (примерно 1.3 витка).
          431-435 - программная 23-спираль. 440-443 - гнутая метионином альфа-спираль (примерно 1.2 витка). 467-471 пи-спираль (примерно 1.2 витка). 469-480 - программная 3335-спираль.

          https://img-fotki.yandex.ru/get/893753/249950893.1/0_16aff1_b0049741_orig.png

          https://img-fotki.yandex.ru/get/510105/249950893.1/0_16aff0_89b162aa_orig.png









          2. 
          https://www.ncbi.nlm.nih.gov/Structure/pdb/5V56

          Crystal structure of a multi-domain human smoothened receptor in complex with a super stabilizing ligand

          Zhang X, Zhao F, Wu Y, Yang J, Han GW, Zhao S, Ishchenko A, Ye L, Lin X, Ding K, Dharmarajan V, Griffin PR, Gati C, Nelson G, Hunter MS, Hanson MA, Cherezov V, Stevens RC, Tan W, Tao H, Xu F

          https://img-fotki.yandex.ru/get/896238/249950893.1/0_16afce_af6cf2b8_orig.png

          http://www.rcsb.org/pdb/explore/explore … ureId=5V56
          https://www.ebi.ac.uk/ena/data/view/AAA … play=fasta

          >ENA|AAA23367|AAA23367.1 Desulfovibrio vulgaris hypothetical protein 
          ATGCCCAAAGCCCTCATCGTCTACGGTTCCACCACAGGCAACACGGAATACACCGCCGAA
          ACCATCGCACGTGAACTTGCCGATGCAGGGTACGAAGTCGATAGCCGGGACGCGGCCTCT
          GTCGAGGCTGGCGGTCTCTTCGAAGGCTTCGACCTCGTCCTTCTCGGATGCTCGACGTGG
          GGTGACGACTCCATCGAACTGCAGGACGACTTCATTCCCCTTTTCGACTCCCTCGAAGAG
          ACGGGGGCGCAGGGCCGCAAGGTGGCCTGCTTCGGCTGCGGCGACAGTTCCTACGAGTAC
          TTCTGCGGGGCTGTCGACGCCATCGAAGAGAAGCTCAAGAACCTCGGTGCCGAAATCGTT
          CAGGACGGTCTTCGCATCGATGGCGACCCCCGCGCCGCCCGGGACGACATCGTCGGCTGG
          GCGCATGACGTGAGGGGCGCCATCTAG

          http://nanoworld.org.ru/post/96494/#p96494
          Результаты программы Пикотех

          4-8 - альфа-спираль
          49-53 - альфа-спираль
          57-60 - альфа-спираль
          62-65 - альфа-спираль
          67-71 - альфа-спираль
          75-78 - альфа-спираль
          80-95 - альфа-спираль
          97-103 - альфа-спираль
          105-108 - альфа-спираль
          110-115 - альфа-спираль
          115-121 - программная 35-спираль
          120-127 - программная 3355-спираль
          128-141 - альфа-спираль
          143-148 - альфа-спираль

          https://img-fotki.yandex.ru/get/877700/249950893.1/0_16afc9_75560fe6_orig.png

          https://img-fotki.yandex.ru/get/477847/249950893.1/0_16afeb_a12b3edb_orig.png










          3.
          https://www.ncbi.nlm.nih.gov/Structure/pdb/5W0P

          Identification of Phosphorylation Codes for Arrestin Recruitment by G Protein-Coupled Receptors

          Zhou XE, He Y, de Waal PW, Gao X, Kang Y, Van Eps N, Yin Y, Pal K, Goswami D, White TA, Barty A, Latorraca NR, Chapman HN, Hubbell WL, Dror RO, Stevens RC, Cherezov V, Gurevich VV, Griffin PR, Ernst OP, Melcher K, Xu HE

          https://img-fotki.yandex.ru/get/476913/249950893.0/0_16a3b9_61f34840_orig.png

          https://www.ebi.ac.uk/ena/data/view/CAD … play=fasta

          >ENA|CAD97623|CAD97623.1 Homo sapiens (human) hypothetical protein 
          ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTA
          CGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTG
          GCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTAC
          GTCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCC
          GTGGCTGACCTCTTCATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCAT
          GGATACTTCGTCTTCGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGC
          GGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGT
          AAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATGGGCGTTGCCTTCACC
          TGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAGGTACATCCCC
          GAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAAC
          GAGTCTTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTT
          TTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAGGCCGCTGCCCAGCAGCAGGAGTCA
          GCCACCACACAGAAGGCAGAGAAGGAGGTCACCCGCATGGTCATCATCATGGTCATCGCT
          TTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGC
          TCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCCAAGAGCGCCGCCATC
          TACAACCCTGTCATCTATATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCACCACC
          ATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACG
          GAGACGAGCCAGGTGGCCCCGGCCTAA

          http://nanoworld.org.ru/post/96490/#p96490
          Программа Пикотех показывает

          8-14 - альфа-спираль.
          21-26 - альфа-спираль.
          28-31 - альфа-спираль.
          35-44 - альфа-спираль.
          46-70 - 310-альфа-спираль.
          72-78 - альфа-спираль.
          83-87 - альфа-спираль.
          90-97 - альфа-спираль.
          102-107 - альфа-спираль.
          112-115 - альфа-спираль.
          117-120 - альфа-спираль.
          124-139 - альфа-спираль.
          141-151 - альфа-спираль.
          153-156 - альфа-спираль.
          158-168 - альфа-спираль.
          172-186 - альфа-спираль.
          189-201 - альфа-спираль.
          204-216 - альфа-спираль.
          215-225 - программная 355-спираль.
          224-233 - альфа-спираль.
          235-239 - альфа-спираль.
          238-248 - программная 255-спираль.
          247-259 - альфа-спираль.
          261-271 - альфа-спираль.
          273-283 - альфа-спираль.
          285-290 - альфа-спираль.
          295-302 - альфа-спираль.
          307-326 - альфа-спираль.
          336-348 - альфа-спираль.

          https://img-fotki.yandex.ru/get/516062/249950893.1/0_16afec_886d280e_orig.png

          https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcc_519f9d05_orig.png













          4.
          https://www.ncbi.nlm.nih.gov/Structure/pdb/5XEZ

          Structure of the full-length glucagon class B G-protein-coupled receptor

          Zhang H, Qiao A, Yang D, Yang L, Dai A, de Graaf C, Reedtz-Runge S, Dharmarajan V, Zhang H, Han GW, Grant TD, Sierra RG, Weierstall U, Nelson G, Liu W, Wu Y, Ma L, Cai X, Lin G, Wu X, Geng Z, Dong Y, Song G, Griffin PR, Lau J, Cherezov V, Yang H, Hanson MA, Stevens RC, Zhao Q, Jiang H, Wang MW, Wu B

          https://img-fotki.yandex.ru/get/762837/249950893.1/0_16afcd_1b4a76df_orig.png

          http://www.rcsb.org/pdb/explore/explore … ureId=5XEZ
          http://www.uniprot.org/uniprot/P47871
          https://www.ebi.ac.uk/ena/data/view/AAC … play=fasta

          >ENA|AAC52063|AAC52063.1 Homo sapiens (human) glucagon receptor 
          ATGCCCCCCTGCCAGCCACAGCGACCCCTGCTGCTGTTGCTGCTGCTGCTGGCCTGCCAG
          CCACAGGTCCCCTCCGCTCAGGTGATGGACTTCCTGTTTGAGAAGTGGAAGCTCTACGGT
          GACCAGTGTCACCACAACCTGAGCCTGCTGCCCCCTCCCACGGAGCTGGTGTGCAACAGA
          ACCTTCGACAAGTATTCCTGCTGGCCGGACACCCCCGCCAATACCACGGCCAACATCTCC
          TGCCCCTGGTACCTGCCTTGGCACCACAAAGTGCAACACCGCTTCGTGTTCAAGAGATGC
          GGGCCCGACGGTCAGTGGGTGCGTGGACCCCGGGGGCAGCCTTGGCGTGATGCCTCCCAG
          TGCCAGATGGATGGCGAGGAGATTGAGGTCCAGAAGGAGGTGGCCAAGATGTACAGCAGC
          TTCCAGGTGATGTACACAGTGGGCTACAGCCTGTCCCTGGGGGCGCTGCTCCTCGCCTTG
          GCCATCCTGGGGGGCCTCAGCAAGCTGCACTGCACCCGCAATGCCATCCACGCGAATCTG
          TTTGCGTCCTTCGTGCTGAAAGCCAGCTCCGTGCTGGTCATTGATGGGCTGCTCAGGACC
          CGCTACAGCCAGAAAATTGGCGACGACCTCAGTGTCAGCACCTGGCTCAGTGATGGAGCG
          GTGGCTGGCTGCCGTGTGGCCGCGGTGTTCATGCAATATGGCATCGTGGCCAACTACTGC
          TGGCTGCTGGTGGAGGGCCTGTACCTGCACAACCTGCTGGGCCTGGCCACCCTCCCCGAG
          AGGAGCTTCTTCAGCCTCTACCTGGGCATCGGCTGGGGTGCCCCCATGCTGTTCGTCGTC
          CCCTGGGCAGTGGTCAAGTGTCTGTTCGAGAACGTCCAGTGCTGGACCAGCAATGACAAC
          ATGGGCTTCTGGTGGATCCTGCGGTTCCCCGTCTTCCTGGCCATCCTGATCAACTTCTTC
          ATCTTCGTCCGCATCGTTCAGCTGCTCGTGGCCAAGCTGCGGGCACGGCAGATGCACCAC
          ACAGACTACAAGTTCCGGCTGGCCAAGTCCACGCTGACCCTCATCCCTCTGCTGGGCGTC
          CACGAAGTGGTCTTCGCCTTCGTGACGGACGAGCACGCCCAGGGCACCCTGCGCTCCGCC
          AAGCTCTTCTTCGACCTCTTCCTCAGCTCCTTCCAGGGCCTGCTGGTGGCTGTCCTCTAC
          TGCTTCCTCAACAAGGAGGTGCAGTCGGAGCTGCGGCGGCGTTGGCACCGCTGGCGCCTG
          GGCAAAGTGCTATGGGAGGAGCGGAACACCAGCAACCACAGGGCCTCATCTTCGCCCGGC
          CACGGCCCTCCCAGCAAGGAGCTGCAGTTTGGGAGGGGTGGTGGCAGCCAGGATTCATCT
          GCGGAGACCCCCTTGGCTGGTGGCCTCCCTAGATTGGCTGAGAGCCCCTTCTGA

          http://nanoworld.org.ru/post/96505/#p96505
          Программа Пикотех показывает

          147-173 - наиболее протяженный участок альфа-310-спирали. 
          Весь белок представлен преимущественно участками альфа-310-спиралей.

          https://img-fotki.yandex.ru/get/509739/249950893.1/0_16b0a0_f8fd49ff_orig.png

          https://img-fotki.yandex.ru/get/893904/249950893.1/0_16b0a1_6da31b90_orig.png










          5.
          https://www.ncbi.nlm.nih.gov/pubmed/17962520
          https://www.ncbi.nlm.nih.gov/Structure/ … ;uid=60314

          High-resolution crystal structure of an engineered human beta2-adrenergic G protein-coupled receptor.

          Cherezov V1, Rosenbaum DM, Hanson MA, Rasmussen SG, Thian FS, Kobilka TS, Choi HJ, Kuhn P, Weis WI, Kobilka BK, Stevens RC.

          https://img-fotki.yandex.ru/get/893240/249950893.0/0_16a3b1_d636e8c2_orig.png

          https://www.rcsb.org/pdb/explore/explor … ureId=2RH1

          https://img-fotki.yandex.ru/get/6713/249950893.1/0_16afcf_be7ab3f6_orig.png

          http://www.uniprot.org/uniprot/P00720
          https://www.ebi.ac.uk/ena/data/view/CAA28212

          >ENA|CAA28212|CAA28212.1 Enterobacteria phage T4 hypothetical protein 
          ATGAATATATTTGAAATGTTACGTATAGATGAACGTCTTAGACTTAAAATCTATAAAGAC
          ACAGAAGGCTATTACACTATTGGCATCGGTCATTTGCTTACAAAAAGTCCATCACTTAAT
          GCTGCTAAATCTGAATTAGATAAAGCTATTGGGCGTAATTGCAATGGTGTAATTACAAAA
          GATGAGGCTGAAAAACTCTTTAATCAGGATGTTGATGCTGCTGTTCGCGGAATTCTGAGA
          AATGCTAAATTAAAACCGGTTTATGATTCTCTTGATGCGGTTCGTCGCTGTGCATTGATT
          AATATGGTTTTCCAAATGGGAGAAACCGGTGTGGCAGGATTTACTAACTCTTTACGTATG
          CTTCAACAAAAACGCTGGGATGAAGCAGCAGTTAACTTAGCTAAAAGTATATGGTATAAT
          CAAACACCTAATCGCGCAAAACGAGTCATTACAACGTTTAGAACTGGCACTTGGGACGCG
          TATAAAAATCTATAA

          https://img-fotki.yandex.ru/get/517809/249950893.1/0_16afd8_c591449d_orig.png

          https://img-fotki.yandex.ru/get/768139/249950893.1/0_16afd9_74627b67_orig.png

          Контактная информация

          Телефоны
          +7 (903) 2003424
          +7 (916) 8265031
          E-mail
          kushelev20120@yandex.ru
          Александр Кушелеве
          Skype
          kushelev2009
          Telegram
          +79032003424
          Kushelev